Incidental Mutation 'R3841:Atp8b3'
ID277169
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission 040781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R3841 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80529706 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 405 (F405L)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020383
AA Change: F405L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: F405L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220326
AA Change: F405L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
Bmper T A 9: 23,473,431 probably null Het
Btnl7-ps A G 17: 34,542,576 noncoding transcript Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Dgcr6 C A 16: 18,070,213 Y200* probably null Het
Dsp A C 13: 38,197,705 I2210L probably benign Het
Eef1e1 G A 13: 38,656,191 T46I probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fbxw25 A T 9: 109,662,134 Y105* probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hipk2 T C 6: 38,818,926 E136G probably damaging Het
Hsph1 T A 5: 149,620,715 probably null Het
Impdh1 A G 6: 29,202,769 S421P probably damaging Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kmt2a T C 9: 44,831,291 probably benign Het
Ldlrap1 T C 4: 134,750,436 T159A probably damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Map3k10 C A 7: 27,658,364 C663F possibly damaging Het
Me3 A T 7: 89,786,493 N179Y possibly damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Olfr781 A G 10: 129,333,333 I151V probably benign Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Parp4 A T 14: 56,587,778 N120Y probably damaging Het
Ptprb T C 10: 116,346,982 V1521A possibly damaging Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Rcan2 A G 17: 44,036,979 K193R probably benign Het
Rdh19 A T 10: 127,856,886 M141L probably benign Het
Selenok C T 14: 29,973,380 R72* probably null Het
Tbpl1 A G 10: 22,711,908 probably benign Het
Tnxb A G 17: 34,698,923 E2270G possibly damaging Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Utp20 A T 10: 88,775,203 probably benign Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Zfp773 A G 7: 7,132,391 V402A possibly damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCAGGGCCACATGTACCATG -3'
(R):5'- CATGTTTATCATGTGAGTGCCG -3'

Sequencing Primer
(F):5'- AGGGCCACATGTACCATGATCTG -3'
(R):5'- TCCAGGCAGGGTGTGGTC -3'
Posted On2015-04-06