Incidental Mutation 'R3842:Adamts16'
ID 277215
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 16
Synonyms
MMRRC Submission 040782-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3842 (G1)
Quality Score 156
Status Validated
Chromosome 13
Chromosomal Location 70875921-70989930 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70887010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 958 (Y958C)
Ref Sequence ENSEMBL: ENSMUSP00000079041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000123552]
AlphaFold Q69Z28
Predicted Effect possibly damaging
Transcript: ENSMUST00000080145
AA Change: Y958C

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: Y958C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123552
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Meta Mutation Damage Score 0.1936 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,251,543 (GRCm38) R318H probably damaging Het
Apol7e A G 15: 77,601,789 (GRCm39) E129G probably damaging Het
Bmp2k A G 5: 97,235,010 (GRCm39) probably benign Het
Camk2g T C 14: 20,814,966 (GRCm39) H26R probably damaging Het
Cpn2 A G 16: 30,079,336 (GRCm39) S122P probably damaging Het
Dhcr24 G T 4: 106,443,002 (GRCm39) G346C probably damaging Het
Egf G A 3: 129,491,442 (GRCm39) R351* probably null Het
Exosc10 T A 4: 148,648,322 (GRCm39) Y260* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam83h C T 15: 75,874,499 (GRCm39) R946K probably benign Het
Fbxo30 A G 10: 11,165,856 (GRCm39) S193G probably damaging Het
Grik3 T C 4: 125,587,747 (GRCm39) probably benign Het
Gtf3c6 A T 10: 40,130,317 (GRCm39) probably null Het
Hivep1 T C 13: 42,311,203 (GRCm39) S1148P probably benign Het
Hmgb2 T A 8: 57,966,388 (GRCm39) S121T probably benign Het
Hyal2 T C 9: 107,449,320 (GRCm39) S359P probably damaging Het
Itgbl1 A G 14: 124,077,977 (GRCm39) T156A possibly damaging Het
Lrrk2 C A 15: 91,640,119 (GRCm39) Q1555K probably benign Het
Myom1 T C 17: 71,352,619 (GRCm39) V349A probably damaging Het
Naa40 A T 19: 7,207,174 (GRCm39) probably benign Het
Ncam2 A G 16: 81,231,698 (GRCm39) Y54C probably damaging Het
Nemf C T 12: 69,378,723 (GRCm39) S533N probably damaging Het
Nkain1 T A 4: 130,537,296 (GRCm38) I80F probably damaging Het
Or10ak12 A G 4: 118,666,452 (GRCm39) V203A probably damaging Het
Or2ag13 G A 7: 106,473,302 (GRCm39) T50I probably benign Het
Or9k2 G A 10: 129,998,770 (GRCm39) R142C probably benign Het
Pde3b T C 7: 114,126,102 (GRCm39) S779P probably damaging Het
Prkar2a A G 9: 108,605,467 (GRCm39) Y175C probably damaging Het
Slc44a5 T C 3: 153,967,031 (GRCm39) probably benign Het
Smgc T A 15: 91,744,460 (GRCm39) probably benign Het
Tasp1 T A 2: 139,793,421 (GRCm39) S252C probably damaging Het
Tgfbrap1 A T 1: 43,098,314 (GRCm39) Y489N probably damaging Het
Topors C T 4: 40,262,123 (GRCm39) R387H probably benign Het
Ttn A G 2: 76,619,963 (GRCm39) S15902P probably damaging Het
Ttn T C 2: 76,680,647 (GRCm39) probably null Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70,943,603 (GRCm39) missense probably benign 0.01
IGL01338:Adamts16 APN 13 70,984,234 (GRCm39) missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70,941,260 (GRCm39) missense probably benign 0.01
IGL01804:Adamts16 APN 13 70,949,080 (GRCm39) nonsense probably null
IGL01874:Adamts16 APN 13 70,916,823 (GRCm39) missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70,935,266 (GRCm39) missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70,921,048 (GRCm39) missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02357:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02429:Adamts16 APN 13 70,935,289 (GRCm39) splice site probably benign
IGL02450:Adamts16 APN 13 70,984,419 (GRCm39) missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70,886,897 (GRCm39) critical splice donor site probably null
IGL03356:Adamts16 APN 13 70,901,410 (GRCm39) missense probably benign 0.00
swap UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
switcheroo UTSW 13 70,949,073 (GRCm39) missense probably benign
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0201:Adamts16 UTSW 13 70,927,763 (GRCm39) missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70,927,730 (GRCm39) missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70,927,671 (GRCm39) missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70,887,074 (GRCm39) missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70,916,766 (GRCm39) missense probably benign
R0524:Adamts16 UTSW 13 70,949,013 (GRCm39) missense probably benign 0.00
R0590:Adamts16 UTSW 13 70,949,073 (GRCm39) missense probably benign
R0734:Adamts16 UTSW 13 70,886,600 (GRCm39) splice site probably benign
R0787:Adamts16 UTSW 13 70,886,948 (GRCm39) missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70,916,811 (GRCm39) missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70,911,680 (GRCm39) splice site probably benign
R1027:Adamts16 UTSW 13 70,915,921 (GRCm39) missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1535:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably null
R1617:Adamts16 UTSW 13 70,946,154 (GRCm39) missense probably benign 0.09
R1700:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70,927,717 (GRCm39) splice site probably null
R1869:Adamts16 UTSW 13 70,883,866 (GRCm39) missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70,940,005 (GRCm39) missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70,901,386 (GRCm39) missense probably benign 0.39
R2018:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70,949,126 (GRCm39) missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3411:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R4117:Adamts16 UTSW 13 70,916,111 (GRCm39) missense probably benign 0.01
R4435:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70,927,743 (GRCm39) missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70,901,315 (GRCm39) nonsense probably null
R5464:Adamts16 UTSW 13 70,909,868 (GRCm39) missense probably benign 0.01
R5613:Adamts16 UTSW 13 70,878,253 (GRCm39) missense probably benign 0.01
R5667:Adamts16 UTSW 13 70,984,494 (GRCm39) nonsense probably null
R5735:Adamts16 UTSW 13 70,984,337 (GRCm39) missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70,886,617 (GRCm39) missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70,877,029 (GRCm39) missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70,918,393 (GRCm39) nonsense probably null
R6351:Adamts16 UTSW 13 70,984,322 (GRCm39) missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70,927,689 (GRCm39) missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70,877,017 (GRCm39) missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70,916,639 (GRCm39) splice site probably null
R6996:Adamts16 UTSW 13 70,946,157 (GRCm39) critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70,921,074 (GRCm39) nonsense probably null
R7356:Adamts16 UTSW 13 70,984,399 (GRCm39) missense probably benign 0.03
R7509:Adamts16 UTSW 13 70,935,283 (GRCm39) missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70,878,234 (GRCm39) missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70,984,265 (GRCm39) missense probably damaging 0.97
R7968:Adamts16 UTSW 13 70,886,701 (GRCm39) missense probably benign
R8231:Adamts16 UTSW 13 70,925,599 (GRCm39) missense probably damaging 0.99
R8232:Adamts16 UTSW 13 70,941,217 (GRCm39) missense probably damaging 1.00
R8470:Adamts16 UTSW 13 70,984,496 (GRCm39) missense probably damaging 1.00
R8485:Adamts16 UTSW 13 70,886,794 (GRCm39) missense possibly damaging 0.89
R8772:Adamts16 UTSW 13 70,984,453 (GRCm39) missense probably damaging 1.00
R8916:Adamts16 UTSW 13 70,941,307 (GRCm39) missense probably damaging 1.00
R8921:Adamts16 UTSW 13 70,939,910 (GRCm39) splice site probably benign
R8973:Adamts16 UTSW 13 70,886,959 (GRCm39) missense probably benign 0.00
R9132:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9149:Adamts16 UTSW 13 70,883,948 (GRCm39) missense probably damaging 1.00
R9159:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9312:Adamts16 UTSW 13 70,949,045 (GRCm39) missense probably damaging 1.00
R9584:Adamts16 UTSW 13 70,949,136 (GRCm39) missense probably damaging 1.00
Z1176:Adamts16 UTSW 13 70,909,892 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAGCACTGCATAAGAGAGC -3'
(R):5'- GTCACTGGAAAACCATGGGC -3'

Sequencing Primer
(F):5'- AACTTTCAGTGAAGGTGTTCCACG -3'
(R):5'- CTGGAAAACCATGGGCATCTGTTAC -3'
Posted On 2015-04-06