Incidental Mutation 'R3843:Grap'
ID 277255
Institutional Source Beutler Lab
Gene Symbol Grap
Ensembl Gene ENSMUSG00000004837
Gene Name GRB2-related adaptor protein
Synonyms 8430435N19Rik
MMRRC Submission 040783-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3843 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 61544091-61563610 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to G at 61551151 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004959]
AlphaFold Q9CX99
Predicted Effect probably null
Transcript: ENSMUST00000004959
SMART Domains Protein: ENSMUSP00000004959
Gene: ENSMUSG00000004837

DomainStartEndE-ValueType
SH3 1 57 5.43e-18 SMART
SH2 58 141 1.9e-33 SMART
SH3 161 216 3.32e-22 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GRB2/Sem5/Drk family and functions as a cytoplasmic signaling protein which contains an SH2 domain flanked by two SH3 domains. The SH2 domain interacts with ligand-activated receptors for stem cell factor and erythropoietin, and facilitates the formation of a stable complex with the BCR-ABL oncoprotein. This protein also associates with the Ras guanine nucleotide exchange factor SOS1 (son of sevenless homolog 1) through its N-terminal SH3 domain. In general, it couples signals from receptor and cytoplasmic tyrosine kinases to the Ras signaling pathway. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display a greater proliferative T cell response to TCR stimulation. In all other respects, they are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,495 (GRCm39) Y168* probably null Het
Amt C T 9: 108,174,420 (GRCm39) R62C possibly damaging Het
Arid2 C T 15: 96,249,721 (GRCm39) T145I possibly damaging Het
Ccdc8 T C 7: 16,729,039 (GRCm39) V176A probably damaging Het
Cdhr1 G T 14: 36,806,884 (GRCm39) F440L probably benign Het
Ckap2 A T 8: 22,665,774 (GRCm39) N424K probably damaging Het
Col6a1 C T 10: 76,547,175 (GRCm39) R730H unknown Het
Dennd1b C A 1: 138,981,092 (GRCm39) P102Q probably damaging Het
E2f1 A G 2: 154,402,748 (GRCm39) S340P probably benign Het
Eef1akmt2 C T 7: 132,433,305 (GRCm39) V134I probably damaging Het
Elp3 A T 14: 65,802,932 (GRCm39) probably null Het
Heatr1 T C 13: 12,450,002 (GRCm39) Y1999H probably benign Het
Hectd4 G T 5: 121,397,936 (GRCm39) W288L possibly damaging Het
Hnf4g G A 3: 3,716,362 (GRCm39) C262Y probably benign Het
Hrh4 A G 18: 13,155,343 (GRCm39) Y294C possibly damaging Het
Igkv5-39 C A 6: 69,877,526 (GRCm39) G77W probably damaging Het
Kdm2b A T 5: 123,072,856 (GRCm39) Y341N probably damaging Het
Kif26b T C 1: 178,755,742 (GRCm39) L1952P probably damaging Het
Lgr4 C T 2: 109,827,118 (GRCm39) probably benign Het
Nlrc3 G A 16: 3,782,828 (GRCm39) R194W probably benign Het
Nup214 T C 2: 31,941,112 (GRCm39) F547L probably damaging Het
Or5m3 A G 2: 85,838,548 (GRCm39) I143V probably benign Het
Pdp1 T C 4: 11,961,961 (GRCm39) K117E probably benign Het
Phtf2 G A 5: 20,979,020 (GRCm39) A31V probably damaging Het
Pip4p2 T A 4: 14,886,553 (GRCm39) Y42* probably null Het
Pkhd1 A T 1: 20,628,947 (GRCm39) C667S probably benign Het
Pnp2 T A 14: 51,200,878 (GRCm39) L121Q probably null Het
Ppfia1 C T 7: 144,058,707 (GRCm39) R698Q probably benign Het
Sidt1 A T 16: 44,104,587 (GRCm39) F275I probably benign Het
Slc50a1 A T 3: 89,177,207 (GRCm39) I70N probably damaging Het
Sytl2 C G 7: 90,009,367 (GRCm39) T123R possibly damaging Het
Tlk1 T A 2: 70,579,671 (GRCm39) T214S probably benign Het
Tmco3 A G 8: 13,346,114 (GRCm39) probably benign Het
Trim71 T C 9: 114,344,914 (GRCm39) T335A probably benign Het
Zbtb47 T A 9: 121,592,499 (GRCm39) V273E possibly damaging Het
Other mutations in Grap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0833:Grap UTSW 11 61,551,065 (GRCm39) missense possibly damaging 0.73
R0836:Grap UTSW 11 61,551,065 (GRCm39) missense possibly damaging 0.73
R1103:Grap UTSW 11 61,562,544 (GRCm39) missense probably benign 0.01
R1479:Grap UTSW 11 61,551,124 (GRCm39) missense probably benign 0.26
R1869:Grap UTSW 11 61,555,015 (GRCm39) missense possibly damaging 0.94
R3903:Grap UTSW 11 61,551,151 (GRCm39) splice site probably null
R4939:Grap UTSW 11 61,551,124 (GRCm39) missense probably damaging 1.00
R6670:Grap UTSW 11 61,551,064 (GRCm39) missense probably damaging 1.00
R8733:Grap UTSW 11 61,562,517 (GRCm39) missense possibly damaging 0.79
R9343:Grap UTSW 11 61,562,551 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGGCCTGTGAGATGCCATAG -3'
(R):5'- CGTCCCAGACCTAAGATATCTG -3'

Sequencing Primer
(F):5'- TGAGATGCCATAGGTCCCCATC -3'
(R):5'- GATATCTGGGCCAAACTAGACTTC -3'
Posted On 2015-04-06