Incidental Mutation 'R3843:Heatr1'
ID277256
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12435121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1999 (Y1999H)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000099820] [ENSMUST00000099821] [ENSMUST00000124888] [ENSMUST00000135166] [ENSMUST00000143693]
Predicted Effect probably benign
Transcript: ENSMUST00000059270
AA Change: Y1999H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: Y1999H

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099820
SMART Domains Protein: ENSMUSP00000097408
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099821
SMART Domains Protein: ENSMUSP00000097409
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124888
SMART Domains Protein: ENSMUSP00000115094
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133143
Predicted Effect probably benign
Transcript: ENSMUST00000135166
SMART Domains Protein: ENSMUSP00000120210
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143693
SMART Domains Protein: ENSMUSP00000118925
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221616
Predicted Effect unknown
Transcript: ENSMUST00000222091
AA Change: Y599H
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAAAGGAGAGCCCCATCTG -3'
(R):5'- GACTAAGCCTTGTAAGCTATCATG -3'

Sequencing Primer
(F):5'- GTTGTACCATTTACAGCTTCTAGG -3'
(R):5'- TGTCACATATACAAACCCTGCAGAG -3'
Posted On2015-04-06