Incidental Mutation 'R3844:Adam5'
ID277277
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.025) question?
Stock #R3844 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24813410 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 167 (D167V)
Ref Sequence ENSEMBL: ENSMUSP00000147290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect probably benign
Transcript: ENSMUST00000050300
AA Change: D167V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: D167V

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118419
AA Change: D167V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: D167V

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130939
Predicted Effect unknown
Transcript: ENSMUST00000132180
AA Change: D84V
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: D84V

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209935
AA Change: D167V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A T 11: 6,200,032 R2* probably null Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Aqp11 T A 7: 97,737,839 E50V probably damaging Het
Arid4b C T 13: 14,187,060 S703L probably damaging Het
Ccl25 T G 8: 4,354,183 V179G possibly damaging Het
Clk2 A G 3: 89,170,403 N222S probably benign Het
Col13a1 C T 10: 61,850,209 G668D unknown Het
Col20a1 A G 2: 180,992,449 E69G probably damaging Het
Dcc G A 18: 71,826,186 H172Y probably benign Het
Dock8 T G 19: 25,065,430 Y125* probably null Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Fars2 T C 13: 36,205,101 F191S probably damaging Het
Filip1l T C 16: 57,572,427 V888A probably benign Het
Fn1 T A 1: 71,609,574 H1392L possibly damaging Het
Fsip2 C T 2: 82,989,606 H5228Y possibly damaging Het
Galnt14 A G 17: 73,709,929 probably null Het
Grm8 A T 6: 27,429,508 N462K possibly damaging Het
Ireb2 A G 9: 54,892,505 E410G probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kdm7a T A 6: 39,181,579 I77F probably damaging Het
Klhl11 A T 11: 100,472,307 M141K possibly damaging Het
Lactbl1 A G 4: 136,637,960 H541R possibly damaging Het
Mylk A G 16: 34,921,877 M920V probably benign Het
Olfr1369-ps1 A G 13: 21,116,063 T124A possibly damaging Het
Piwil4 T A 9: 14,729,960 T179S possibly damaging Het
Ranbp2 T C 10: 58,477,895 L1479P possibly damaging Het
Rpl3l A G 17: 24,733,942 H292R probably benign Het
Rps6ka4 C A 19: 6,837,803 E202* probably null Het
Rsph14 T C 10: 75,031,275 D13G possibly damaging Het
Sri A G 5: 8,064,576 D177G probably damaging Het
Tenm2 A G 11: 36,047,538 V1437A probably damaging Het
Tiam2 A G 17: 3,421,651 R523G probably damaging Het
Tm9sf3 A T 19: 41,217,116 L561M possibly damaging Het
Tnrc6c G T 11: 117,755,483 D1417Y probably damaging Het
Ubr4 C T 4: 139,459,126 S648L probably damaging Het
Zfp827 T A 8: 79,136,619 L69Q probably damaging Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4514:Adam5 UTSW 8 24818136 missense probably damaging 1.00
R4843:Adam5 UTSW 8 24813536 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4866:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5293:Adam5 UTSW 8 24810706 missense possibly damaging 0.46
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R5859:Adam5 UTSW 8 24813461 missense probably benign
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
R7127:Adam5 UTSW 8 24810781 missense probably damaging 1.00
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTACAAAGTAAAACCATGCCG -3'
(R):5'- TATAACTGTCCGACCACCCAGG -3'

Sequencing Primer
(F):5'- GCCTTTAACATCAGCACTTGGGAG -3'
(R):5'- CACCCAGGGGAATCATACAGTTTG -3'
Posted On2015-04-06