Incidental Mutation 'R3844:Fars2'
ID277293
Institutional Source Beutler Lab
Gene Symbol Fars2
Ensembl Gene ENSMUSG00000021420
Gene Namephenylalanine-tRNA synthetase 2 (mitochondrial)
Synonyms2810431B21Rik, Fars1, 6720478K01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R3844 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location36117412-36726280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36205101 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 191 (F191S)
Ref Sequence ENSEMBL: ENSMUSP00000153019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021857] [ENSMUST00000099582] [ENSMUST00000223796] [ENSMUST00000224241] [ENSMUST00000224611] [ENSMUST00000224916]
Predicted Effect probably damaging
Transcript: ENSMUST00000021857
AA Change: F191S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021857
Gene: ENSMUSG00000021420
AA Change: F191S

DomainStartEndE-ValueType
Pfam:tRNA-synt_2d 69 208 3.3e-18 PFAM
Pfam:tRNA-synt_2d 223 343 9.5e-31 PFAM
FDX-ACB 358 450 1.5e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099582
SMART Domains Protein: ENSMUSP00000097177
Gene: ENSMUSG00000021420

DomainStartEndE-ValueType
Pfam:tRNA-synt_2d 4 111 2.6e-33 PFAM
FDX-ACB 126 218 1.5e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223796
AA Change: F191S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224241
AA Change: F191S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224611
AA Change: F191S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224916
AA Change: F191S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225525
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that transfers phenylalanine to its cognate tRNA. This protein localizes to the mitochondrion and plays a role in mitochondrial protein translation. Mutations in this gene can cause combined oxidative phosphorylation deficiency 14 (Alpers encephalopathy). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A T 11: 6,200,032 R2* probably null Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam5 T A 8: 24,813,410 D167V probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Aqp11 T A 7: 97,737,839 E50V probably damaging Het
Arid4b C T 13: 14,187,060 S703L probably damaging Het
Ccl25 T G 8: 4,354,183 V179G possibly damaging Het
Clk2 A G 3: 89,170,403 N222S probably benign Het
Col13a1 C T 10: 61,850,209 G668D unknown Het
Col20a1 A G 2: 180,992,449 E69G probably damaging Het
Dcc G A 18: 71,826,186 H172Y probably benign Het
Dock8 T G 19: 25,065,430 Y125* probably null Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Filip1l T C 16: 57,572,427 V888A probably benign Het
Fn1 T A 1: 71,609,574 H1392L possibly damaging Het
Fsip2 C T 2: 82,989,606 H5228Y possibly damaging Het
Galnt14 A G 17: 73,709,929 probably null Het
Grm8 A T 6: 27,429,508 N462K possibly damaging Het
Ireb2 A G 9: 54,892,505 E410G probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kdm7a T A 6: 39,181,579 I77F probably damaging Het
Klhl11 A T 11: 100,472,307 M141K possibly damaging Het
Lactbl1 A G 4: 136,637,960 H541R possibly damaging Het
Mylk A G 16: 34,921,877 M920V probably benign Het
Olfr1369-ps1 A G 13: 21,116,063 T124A possibly damaging Het
Piwil4 T A 9: 14,729,960 T179S possibly damaging Het
Ranbp2 T C 10: 58,477,895 L1479P possibly damaging Het
Rpl3l A G 17: 24,733,942 H292R probably benign Het
Rps6ka4 C A 19: 6,837,803 E202* probably null Het
Rsph14 T C 10: 75,031,275 D13G possibly damaging Het
Sri A G 5: 8,064,576 D177G probably damaging Het
Tenm2 A G 11: 36,047,538 V1437A probably damaging Het
Tiam2 A G 17: 3,421,651 R523G probably damaging Het
Tm9sf3 A T 19: 41,217,116 L561M possibly damaging Het
Tnrc6c G T 11: 117,755,483 D1417Y probably damaging Het
Ubr4 C T 4: 139,459,126 S648L probably damaging Het
Zfp827 T A 8: 79,136,619 L69Q probably damaging Het
Other mutations in Fars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Fars2 APN 13 36537311 missense probably benign 0.07
IGL02348:Fars2 APN 13 36537380 missense probably benign 0.00
IGL02406:Fars2 APN 13 36410162 missense probably benign 0.39
IGL02523:Fars2 APN 13 36204693 missense probably damaging 1.00
IGL02896:Fars2 APN 13 36204842 missense probably benign 0.02
IGL03299:Fars2 APN 13 36537410 nonsense probably null
IGL03308:Fars2 APN 13 36204687 missense possibly damaging 0.95
R0419:Fars2 UTSW 13 36537311 missense probably benign 0.07
R0546:Fars2 UTSW 13 36204586 missense probably benign 0.01
R1918:Fars2 UTSW 13 36204546 missense probably damaging 1.00
R3120:Fars2 UTSW 13 36246417 missense probably damaging 1.00
R4716:Fars2 UTSW 13 36205068 missense probably damaging 1.00
R4795:Fars2 UTSW 13 36537426 missense probably damaging 0.97
R4796:Fars2 UTSW 13 36537426 missense probably damaging 0.97
R4979:Fars2 UTSW 13 36204581 missense possibly damaging 0.54
R5262:Fars2 UTSW 13 36342018 missense probably damaging 1.00
R5413:Fars2 UTSW 13 36204562 nonsense probably null
R5475:Fars2 UTSW 13 36204570 missense probably benign
R5635:Fars2 UTSW 13 36410146 missense probably damaging 0.99
R6437:Fars2 UTSW 13 36204863 missense possibly damaging 0.80
X0020:Fars2 UTSW 13 36204795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAGCCTGCTAATCCCAGCTG -3'
(R):5'- CTCACATACATTCTGGCCAGGG -3'

Sequencing Primer
(F):5'- TGCTAATCCCAGCTGACCAC -3'
(R):5'- CAGGGAGGCCAATGCACAC -3'
Posted On2015-04-06