Incidental Mutation 'R3844:Filip1l'
ID277295
Institutional Source Beutler Lab
Gene Symbol Filip1l
Ensembl Gene ENSMUSG00000043336
Gene Namefilamin A interacting protein 1-like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3844 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location57353093-57573126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57572427 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 888 (V888A)
Ref Sequence ENSEMBL: ENSMUSP00000124069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]
Predicted Effect probably benign
Transcript: ENSMUST00000114371
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159414
AA Change: V888A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: V888A

DomainStartEndE-ValueType
coiled coil region 4 345 N/A INTRINSIC
coiled coil region 371 542 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 868 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159816
AA Change: V1126A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: V1126A

DomainStartEndE-ValueType
Pfam:CortBP2 61 246 1.8e-65 PFAM
low complexity region 271 286 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
coiled coil region 609 780 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
low complexity region 1106 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231282
Predicted Effect probably benign
Transcript: ENSMUST00000232413
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A T 11: 6,200,032 R2* probably null Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam5 T A 8: 24,813,410 D167V probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Aqp11 T A 7: 97,737,839 E50V probably damaging Het
Arid4b C T 13: 14,187,060 S703L probably damaging Het
Ccl25 T G 8: 4,354,183 V179G possibly damaging Het
Clk2 A G 3: 89,170,403 N222S probably benign Het
Col13a1 C T 10: 61,850,209 G668D unknown Het
Col20a1 A G 2: 180,992,449 E69G probably damaging Het
Dcc G A 18: 71,826,186 H172Y probably benign Het
Dock8 T G 19: 25,065,430 Y125* probably null Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Fars2 T C 13: 36,205,101 F191S probably damaging Het
Fn1 T A 1: 71,609,574 H1392L possibly damaging Het
Fsip2 C T 2: 82,989,606 H5228Y possibly damaging Het
Galnt14 A G 17: 73,709,929 probably null Het
Grm8 A T 6: 27,429,508 N462K possibly damaging Het
Ireb2 A G 9: 54,892,505 E410G probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kdm7a T A 6: 39,181,579 I77F probably damaging Het
Klhl11 A T 11: 100,472,307 M141K possibly damaging Het
Lactbl1 A G 4: 136,637,960 H541R possibly damaging Het
Mylk A G 16: 34,921,877 M920V probably benign Het
Olfr1369-ps1 A G 13: 21,116,063 T124A possibly damaging Het
Piwil4 T A 9: 14,729,960 T179S possibly damaging Het
Ranbp2 T C 10: 58,477,895 L1479P possibly damaging Het
Rpl3l A G 17: 24,733,942 H292R probably benign Het
Rps6ka4 C A 19: 6,837,803 E202* probably null Het
Rsph14 T C 10: 75,031,275 D13G possibly damaging Het
Sri A G 5: 8,064,576 D177G probably damaging Het
Tenm2 A G 11: 36,047,538 V1437A probably damaging Het
Tiam2 A G 17: 3,421,651 R523G probably damaging Het
Tm9sf3 A T 19: 41,217,116 L561M possibly damaging Het
Tnrc6c G T 11: 117,755,483 D1417Y probably damaging Het
Ubr4 C T 4: 139,459,126 S648L probably damaging Het
Zfp827 T A 8: 79,136,619 L69Q probably damaging Het
Other mutations in Filip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Filip1l APN 16 57572348 nonsense probably null
IGL01393:Filip1l APN 16 57572223 missense probably damaging 1.00
IGL01886:Filip1l APN 16 57571250 missense possibly damaging 0.47
IGL02336:Filip1l APN 16 57571733 intron probably null
IGL02503:Filip1l APN 16 57571575 missense probably benign 0.00
IGL02608:Filip1l APN 16 57572106 missense probably benign 0.05
IGL02681:Filip1l APN 16 57571779 missense probably benign 0.10
IGL02687:Filip1l APN 16 57571127 missense probably benign 0.30
IGL02982:Filip1l APN 16 57572232 missense probably damaging 1.00
IGL03062:Filip1l APN 16 57506804 missense probably damaging 1.00
R1027:Filip1l UTSW 16 57569688 missense probably benign
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1384:Filip1l UTSW 16 57571289 missense possibly damaging 0.61
R1655:Filip1l UTSW 16 57571851 missense probably damaging 1.00
R1764:Filip1l UTSW 16 57570038 missense probably damaging 1.00
R1809:Filip1l UTSW 16 57506660 missense probably benign
R1983:Filip1l UTSW 16 57571274 missense probably damaging 0.98
R2504:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R2504:Filip1l UTSW 16 57571047 missense probably damaging 0.97
R3117:Filip1l UTSW 16 57506732 missense probably benign 0.07
R3871:Filip1l UTSW 16 57513286 missense probably damaging 0.97
R4231:Filip1l UTSW 16 57506768 missense probably benign
R4391:Filip1l UTSW 16 57570792 nonsense probably null
R4700:Filip1l UTSW 16 57570695 missense probably benign 0.00
R4999:Filip1l UTSW 16 57570415 missense probably benign 0.01
R5002:Filip1l UTSW 16 57571103 missense probably benign 0.01
R5123:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R5294:Filip1l UTSW 16 57570036 missense possibly damaging 0.59
R5429:Filip1l UTSW 16 57570255 missense probably damaging 0.99
R5811:Filip1l UTSW 16 57570294 missense probably damaging 1.00
R6220:Filip1l UTSW 16 57569989 missense probably benign 0.31
R6452:Filip1l UTSW 16 57506800 missense possibly damaging 0.82
R6678:Filip1l UTSW 16 57569970 missense probably benign 0.00
R6700:Filip1l UTSW 16 57571248 missense possibly damaging 0.86
R7260:Filip1l UTSW 16 57570924 missense probably damaging 1.00
R7327:Filip1l UTSW 16 57570937 missense probably damaging 1.00
Z1088:Filip1l UTSW 16 57513405 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAAGTGTGATAACTACTGAG -3'
(R):5'- GCAGGCAACACATAGTTAGTTCC -3'

Sequencing Primer
(F):5'- GAAGTCCTTACATGCAAGCTGTG -3'
(R):5'- GGCAACACATAGTTAGTTCCAGATAC -3'
Posted On2015-04-06