Incidental Mutation 'R3845:Grid2'
ID277321
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Nameglutamate receptor, ionotropic, delta 2
SynonymsGluRdelta2, tpr, B230104L07Rik
MMRRC Submission 040893-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3845 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location63255876-64704323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64345842 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 609 (M609V)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095852
AA Change: M609V

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: M609V

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apool A T X: 112,364,458 probably benign Het
Atp4a A G 7: 30,717,115 N439S probably null Het
AU041133 T A 10: 82,151,318 H268Q probably damaging Het
Ccdc105 T C 10: 78,748,698 N330S probably benign Het
Ccdc136 C T 6: 29,417,177 R666W probably benign Het
Ccdc97 T C 7: 25,715,028 probably benign Het
Celf1 T C 2: 91,009,238 V336A possibly damaging Het
Chd3 T C 11: 69,346,759 N1870D possibly damaging Het
Col5a3 C T 9: 20,808,377 D229N unknown Het
Cpn1 G T 19: 43,974,084 P142Q possibly damaging Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Cyp2u1 A G 3: 131,293,486 F482S possibly damaging Het
Foxo1 T A 3: 52,346,280 D621E probably benign Het
Gm13084 T C 4: 143,811,975 E142G probably damaging Het
Gm5346 T C 8: 43,626,632 N185S probably benign Het
Hsd17b3 A T 13: 64,089,062 F23I possibly damaging Het
Kcnk10 A G 12: 98,440,744 I217T probably benign Het
Mis18bp1 G A 12: 65,149,142 S616L possibly damaging Het
Mtch1 A T 17: 29,342,832 F133I probably damaging Het
Myh4 T A 11: 67,259,105 V1830E possibly damaging Het
Nav3 T C 10: 109,853,376 M347V possibly damaging Het
Nbea A G 3: 56,086,292 probably benign Het
Nhej1 A T 1: 74,968,883 D76E probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1024 A C 2: 85,904,737 C106G probably damaging Het
Papd5 A T 8: 88,250,664 I322F possibly damaging Het
Pias3 T C 3: 96,702,210 V307A probably benign Het
Pltp T A 2: 164,854,288 M135L probably benign Het
Plxna2 A G 1: 194,793,790 Y1106C probably damaging Het
Ptgir G A 7: 16,907,386 R201H probably damaging Het
Ptk7 A T 17: 46,586,418 D329E probably benign Het
Pygl T C 12: 70,198,443 D411G probably benign Het
Rev1 A T 1: 38,098,988 M72K probably damaging Het
Sfrp1 T C 8: 23,412,248 L155P probably damaging Het
Slc5a4a A G 10: 76,189,149 E620G probably damaging Het
Smarca2 A G 19: 26,720,873 I1314V probably benign Het
Tas2r109 G A 6: 132,980,803 L55F probably damaging Het
Tek T A 4: 94,804,872 C274S probably damaging Het
Tmem38b T A 4: 53,859,905 D228E probably benign Het
Topbp1 T C 9: 103,309,923 V109A possibly damaging Het
Trbv5 A G 6: 41,062,748 I96V probably benign Het
Trim16 T G 11: 62,836,672 probably benign Het
Upf3a A T 8: 13,798,238 T345S probably benign Het
Usp15 A G 10: 123,119,135 S913P probably damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Zdbf2 A T 1: 63,308,324 H1954L possibly damaging Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably null
swagger UTSW 6 64395280 synonymous probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63931015 missense probably benign 0.01
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
R6999:Grid2 UTSW 6 64076909 missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64700418 missense unknown
R7126:Grid2 UTSW 6 64076810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTGGGAGTCCTTCTTCGAAG -3'
(R):5'- GAAGCCTGCTATGCCTGAGATC -3'

Sequencing Primer
(F):5'- GGATATGTTTGCCTGCCTT -3'
(R):5'- TGCTATGCCTGAGATCCACTAAG -3'
Posted On2015-04-06