Incidental Mutation 'R3846:Ifi207'
ID 277357
Institutional Source Beutler Lab
Gene Symbol Ifi207
Ensembl Gene ENSMUSG00000073490
Gene Name interferon activated gene 207
Synonyms AI607873, Pyhin-A
MMRRC Submission 040894-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R3846 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 173550993-173569313 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 173562869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 92 (E92D)
Ref Sequence ENSEMBL: ENSMUSP00000119350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042610] [ENSMUST00000127730]
AlphaFold E9Q3L4
Predicted Effect probably benign
Transcript: ENSMUST00000042610
AA Change: E92D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048129
Gene: ENSMUSG00000073490
AA Change: E92D

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 162 N/A INTRINSIC
low complexity region 207 215 N/A INTRINSIC
internal_repeat_1 286 472 4.17e-7 PROSPERO
low complexity region 476 496 N/A INTRINSIC
internal_repeat_1 565 782 4.17e-7 PROSPERO
Pfam:HIN 788 954 4.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127730
AA Change: E92D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: E92D

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 155 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
internal_repeat_1 279 465 6.41e-7 PROSPERO
low complexity region 469 489 N/A INTRINSIC
internal_repeat_1 558 775 6.41e-7 PROSPERO
Pfam:HIN 781 948 1.8e-78 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A G 2: 35,244,570 (GRCm39) Y261H probably damaging Het
Acad10 T A 5: 121,772,749 (GRCm39) I511F probably benign Het
Adgb G A 10: 10,258,465 (GRCm39) probably benign Het
Adgrg3 T C 8: 95,767,049 (GRCm39) V468A probably benign Het
Ano4 A T 10: 88,831,114 (GRCm39) I468N possibly damaging Het
Apool A T X: 111,274,155 (GRCm39) probably benign Het
Arhgap32 T C 9: 32,101,320 (GRCm39) V295A probably benign Het
Ccser2 A G 14: 36,662,245 (GRCm39) V313A probably benign Het
Ctnnd1 T C 2: 84,447,271 (GRCm39) I325V probably benign Het
Cubn T C 2: 13,287,819 (GRCm39) D3420G probably damaging Het
Dnah12 A G 14: 26,431,366 (GRCm39) T395A probably benign Het
Dock2 T G 11: 34,623,198 (GRCm39) H65P possibly damaging Het
Fsip2 A T 2: 82,816,759 (GRCm39) Q4164L possibly damaging Het
Gapvd1 A T 2: 34,619,084 (GRCm39) Y96* probably null Het
Gja3 T A 14: 57,273,161 (GRCm39) K404* probably null Het
Hdac1-ps A G 17: 78,800,401 (GRCm39) K464R possibly damaging Het
Hmcn2 A G 2: 31,320,362 (GRCm39) I3948V possibly damaging Het
Hr C T 14: 70,808,893 (GRCm39) R1090W probably damaging Het
Hrnr A G 3: 93,239,464 (GRCm39) H3234R unknown Het
Iqgap2 G A 13: 95,810,186 (GRCm39) probably benign Het
Itgax G T 7: 127,732,939 (GRCm39) V273F probably damaging Het
Lamc3 A G 2: 31,814,604 (GRCm39) M1043V probably benign Het
Lgmn T C 12: 102,370,588 (GRCm39) N114S possibly damaging Het
Mov10l1 A G 15: 88,896,345 (GRCm39) N678D possibly damaging Het
Nlrp9c A G 7: 26,081,701 (GRCm39) probably null Het
Notch4 A G 17: 34,797,071 (GRCm39) T940A probably damaging Het
Nudt15 T A 14: 73,760,911 (GRCm39) Q60L probably benign Het
Or10ag56 T C 2: 87,139,526 (GRCm39) V151A probably benign Het
Or52e7 T C 7: 104,684,896 (GRCm39) C164R probably benign Het
Phip G A 9: 82,758,179 (GRCm39) R1505* probably null Het
Ptger2 T G 14: 45,226,784 (GRCm39) S121R probably damaging Het
Scyl2 A T 10: 89,476,403 (GRCm39) F907L probably damaging Het
Silc1 T A 12: 27,210,301 (GRCm39) noncoding transcript Het
Trpc4 C A 3: 54,225,433 (GRCm39) F843L probably benign Het
Tysnd1 C T 10: 61,531,867 (GRCm39) S173L possibly damaging Het
Vmn2r124 T A 17: 18,293,953 (GRCm39) V680D possibly damaging Het
Vmn2r91 G A 17: 18,327,860 (GRCm39) V485I probably benign Het
Other mutations in Ifi207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Ifi207 APN 1 173,552,610 (GRCm39) missense probably damaging 1.00
IGL01864:Ifi207 APN 1 173,564,007 (GRCm39) missense possibly damaging 0.72
IGL02293:Ifi207 APN 1 173,551,314 (GRCm39) missense probably damaging 1.00
IGL02402:Ifi207 APN 1 173,555,159 (GRCm39) missense probably damaging 1.00
IGL03160:Ifi207 APN 1 173,562,670 (GRCm39) splice site probably benign
PIT4458001:Ifi207 UTSW 1 173,562,738 (GRCm39) missense unknown
R0043:Ifi207 UTSW 1 173,556,678 (GRCm39) missense possibly damaging 0.48
R0212:Ifi207 UTSW 1 173,563,964 (GRCm39) missense possibly damaging 0.85
R0395:Ifi207 UTSW 1 173,557,431 (GRCm39) missense possibly damaging 0.85
R0506:Ifi207 UTSW 1 173,563,878 (GRCm39) missense possibly damaging 0.52
R0843:Ifi207 UTSW 1 173,555,143 (GRCm39) missense probably damaging 1.00
R1302:Ifi207 UTSW 1 173,562,861 (GRCm39) missense possibly damaging 0.96
R1373:Ifi207 UTSW 1 173,557,913 (GRCm39) missense unknown
R1462:Ifi207 UTSW 1 173,552,513 (GRCm39) missense probably damaging 1.00
R1462:Ifi207 UTSW 1 173,552,513 (GRCm39) missense probably damaging 1.00
R1471:Ifi207 UTSW 1 173,557,629 (GRCm39) missense unknown
R1502:Ifi207 UTSW 1 173,556,872 (GRCm39) missense possibly damaging 0.56
R1533:Ifi207 UTSW 1 173,555,306 (GRCm39) missense probably benign 0.30
R1831:Ifi207 UTSW 1 173,559,992 (GRCm39) missense unknown
R1928:Ifi207 UTSW 1 173,557,211 (GRCm39) missense possibly damaging 0.68
R1982:Ifi207 UTSW 1 173,562,805 (GRCm39) missense probably benign 0.01
R2132:Ifi207 UTSW 1 173,557,337 (GRCm39) missense possibly damaging 0.84
R2248:Ifi207 UTSW 1 173,564,036 (GRCm39) splice site probably benign
R3703:Ifi207 UTSW 1 173,555,029 (GRCm39) nonsense probably null
R3741:Ifi207 UTSW 1 173,555,128 (GRCm39) missense probably damaging 1.00
R4747:Ifi207 UTSW 1 173,556,633 (GRCm39) missense probably benign 0.00
R4772:Ifi207 UTSW 1 173,555,253 (GRCm39) missense probably damaging 1.00
R4776:Ifi207 UTSW 1 173,557,622 (GRCm39) missense unknown
R4855:Ifi207 UTSW 1 173,557,381 (GRCm39) missense probably damaging 0.96
R5170:Ifi207 UTSW 1 173,558,064 (GRCm39) missense unknown
R5244:Ifi207 UTSW 1 173,557,503 (GRCm39) missense probably benign 0.04
R5280:Ifi207 UTSW 1 173,557,870 (GRCm39) missense unknown
R5301:Ifi207 UTSW 1 173,556,977 (GRCm39) missense possibly damaging 0.83
R5334:Ifi207 UTSW 1 173,555,097 (GRCm39) missense probably benign 0.21
R5445:Ifi207 UTSW 1 173,555,363 (GRCm39) missense probably damaging 0.99
R5691:Ifi207 UTSW 1 173,559,992 (GRCm39) missense unknown
R5838:Ifi207 UTSW 1 173,559,953 (GRCm39) missense unknown
R6060:Ifi207 UTSW 1 173,558,093 (GRCm39) missense unknown
R6220:Ifi207 UTSW 1 173,557,112 (GRCm39) missense probably damaging 0.99
R6264:Ifi207 UTSW 1 173,555,111 (GRCm39) missense probably damaging 1.00
R6307:Ifi207 UTSW 1 173,552,619 (GRCm39) missense probably damaging 1.00
R6326:Ifi207 UTSW 1 173,557,532 (GRCm39) missense probably benign 0.01
R6394:Ifi207 UTSW 1 173,556,581 (GRCm39) missense probably benign 0.43
R6532:Ifi207 UTSW 1 173,557,211 (GRCm39) missense possibly damaging 0.68
R6660:Ifi207 UTSW 1 173,556,972 (GRCm39) missense probably benign 0.01
R6893:Ifi207 UTSW 1 173,555,208 (GRCm39) missense possibly damaging 0.95
R7190:Ifi207 UTSW 1 173,557,818 (GRCm39) missense unknown
R7192:Ifi207 UTSW 1 173,556,584 (GRCm39) missense not run
R7194:Ifi207 UTSW 1 173,557,490 (GRCm39) missense possibly damaging 0.84
R7327:Ifi207 UTSW 1 173,556,581 (GRCm39) missense probably benign 0.43
R7348:Ifi207 UTSW 1 173,556,762 (GRCm39) small deletion probably benign
R7404:Ifi207 UTSW 1 173,556,494 (GRCm39) missense possibly damaging 0.92
R7442:Ifi207 UTSW 1 173,554,997 (GRCm39) missense probably benign 0.03
R7784:Ifi207 UTSW 1 173,557,698 (GRCm39) missense unknown
R8041:Ifi207 UTSW 1 173,555,268 (GRCm39) missense possibly damaging 0.78
R8116:Ifi207 UTSW 1 173,557,746 (GRCm39) missense unknown
R8166:Ifi207 UTSW 1 173,557,504 (GRCm39) missense probably benign 0.10
R8166:Ifi207 UTSW 1 173,557,166 (GRCm39) missense possibly damaging 0.95
R8168:Ifi207 UTSW 1 173,557,504 (GRCm39) missense probably benign 0.10
R8383:Ifi207 UTSW 1 173,556,770 (GRCm39) small deletion probably benign
R8388:Ifi207 UTSW 1 173,557,016 (GRCm39) frame shift probably null
R8389:Ifi207 UTSW 1 173,557,016 (GRCm39) frame shift probably null
R8390:Ifi207 UTSW 1 173,557,016 (GRCm39) frame shift probably null
R8399:Ifi207 UTSW 1 173,557,844 (GRCm39) missense unknown
R8431:Ifi207 UTSW 1 173,558,070 (GRCm39) missense unknown
R8474:Ifi207 UTSW 1 173,556,605 (GRCm39) missense possibly damaging 0.63
R8505:Ifi207 UTSW 1 173,557,016 (GRCm39) frame shift probably null
R9009:Ifi207 UTSW 1 173,555,382 (GRCm39) missense probably damaging 0.97
R9061:Ifi207 UTSW 1 173,564,153 (GRCm39) intron probably benign
R9071:Ifi207 UTSW 1 173,557,764 (GRCm39) missense unknown
R9090:Ifi207 UTSW 1 173,556,762 (GRCm39) small deletion probably benign
R9323:Ifi207 UTSW 1 173,555,143 (GRCm39) missense probably damaging 1.00
R9407:Ifi207 UTSW 1 173,555,234 (GRCm39) missense probably damaging 1.00
R9493:Ifi207 UTSW 1 173,556,522 (GRCm39) missense probably benign 0.00
R9629:Ifi207 UTSW 1 173,556,561 (GRCm39) small deletion probably benign
RF009:Ifi207 UTSW 1 173,556,558 (GRCm39) missense probably benign 0.00
RF011:Ifi207 UTSW 1 173,556,687 (GRCm39) missense not run
RF032:Ifi207 UTSW 1 173,562,723 (GRCm39) small deletion probably benign
X0003:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0004:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0005:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0009:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0010:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0011:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0012:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0013:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0014:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0017:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0018:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0019:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0020:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0021:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0022:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0023:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0024:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0025:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0026:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0027:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0028:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0033:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0034:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0035:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0036:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0037:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0038:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0039:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0040:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0050:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0052:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0053:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0054:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0057:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0058:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0060:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0061:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0062:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0063:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0064:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0065:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0066:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0067:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
Z1177:Ifi207 UTSW 1 173,557,145 (GRCm39) missense probably damaging 1.00
Z1187:Ifi207 UTSW 1 173,558,093 (GRCm39) missense unknown
Z1192:Ifi207 UTSW 1 173,558,093 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCACCTGGGCTGTAGAAGTC -3'
(R):5'- CAGAAGATGGTATCAAAAGTTGTGC -3'

Sequencing Primer
(F):5'- TGTAGAAGTCCCCGCCTGAG -3'
(R):5'- GGTATCAAAAGTTGTGCCTTTAGAG -3'
Posted On 2015-04-06