Incidental Mutation 'R3847:Proz'
ID277434
Institutional Source Beutler Lab
Gene Symbol Proz
Ensembl Gene ENSMUSG00000031445
Gene Nameprotein Z, vitamin K-dependent plasma glycoprotein
Synonyms
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.027) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13060914-13076026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13073533 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 268 (E268G)
Ref Sequence ENSEMBL: ENSMUSP00000033822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033822] [ENSMUST00000164416] [ENSMUST00000168164] [ENSMUST00000211363] [ENSMUST00000211453]
Predicted Effect probably benign
Transcript: ENSMUST00000033822
AA Change: E268G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033822
Gene: ENSMUSG00000031445
AA Change: E268G

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
GLA 22 86 7.03e-29 SMART
EGF 90 123 1.65e-6 SMART
EGF 128 166 1.19e-3 SMART
Tryp_SPc 182 394 6.49e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164416
SMART Domains Protein: ENSMUSP00000133204
Gene: ENSMUSG00000038542

DomainStartEndE-ValueType
PAM 144 312 4.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165885
Predicted Effect probably benign
Transcript: ENSMUST00000168164
Predicted Effect probably benign
Transcript: ENSMUST00000211363
Predicted Effect probably benign
Transcript: ENSMUST00000211453
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver vitamin K-dependent glycoprotein that is synthesized in the liver and secreted into the plasma. The encoded protein plays a role in regulating blood coagulation by complexing with protein Z-dependent protease inhibitor to directly inhibit activated factor X at the phospholipid surface. Deficiencies in this protein are associated with an increased risk of ischemic arterial diseases and fetal loss. Mutations in this gene are the cause of protein Z deficiency. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: When unchallenged, mice homozygous for a knock-out allele do not express an obvious phenotype; however, homozygotes exhibit significantly reduced survival following collagen/epinephrine-induced thromboembolism and develop enhanced thrombosis in the ferric chloride-induced arterial injury model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Proz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Proz APN 8 13065238 splice site probably benign
IGL01977:Proz APN 8 13066913 missense probably damaging 1.00
IGL02553:Proz APN 8 13065260 missense probably benign 0.00
IGL02991:Proz UTSW 8 13073490 missense probably benign 0.00
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0482:Proz UTSW 8 13073460 nonsense probably null
R1614:Proz UTSW 8 13066904 missense probably damaging 1.00
R1906:Proz UTSW 8 13073686 unclassified probably null
R2230:Proz UTSW 8 13063356 missense probably damaging 0.99
R2232:Proz UTSW 8 13063356 missense probably damaging 0.99
R2444:Proz UTSW 8 13061027 start gained probably benign
R3029:Proz UTSW 8 13061042 missense probably benign
R3850:Proz UTSW 8 13073533 missense probably benign 0.00
R4063:Proz UTSW 8 13064621 missense probably damaging 1.00
R5104:Proz UTSW 8 13066931 missense probably damaging 1.00
R5309:Proz UTSW 8 13061049 missense probably damaging 1.00
R5337:Proz UTSW 8 13066854 missense probably benign 0.01
R5447:Proz UTSW 8 13072578 missense probably benign 0.31
R5876:Proz UTSW 8 13073448 missense probably benign 0.05
R6739:Proz UTSW 8 13073451 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAAGTCCCGGAAGAACACTG -3'
(R):5'- TTCAGGGTCTGTCCGCATTC -3'

Sequencing Primer
(F):5'- CAGGGTTTCACTGAGCAGTC -3'
(R):5'- CCTCGCCATCTGCTTGTGTG -3'
Posted On2015-04-06