Incidental Mutation 'R0145:Ranbp2'
ID29620
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission 038430-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0145 (G1) of strain 722
Quality Score113
Status Validated (trace)
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58480046 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2196 (I2196N)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect probably damaging
Transcript: ENSMUST00000003310
AA Change: I2196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: I2196N

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 93.7%
  • 20x: 82.1%
Validation Efficiency 96% (109/113)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,601,921 E64G probably damaging Het
1810043G02Rik T C 10: 77,983,556 S196P probably benign Het
4931408C20Rik A G 1: 26,687,332 M32T probably benign Het
Actr6 A T 10: 89,728,178 Y77* probably null Het
Aldoart1 A T 4: 72,851,339 S411T probably benign Het
Aqp1 C T 6: 55,346,687 R234C probably damaging Het
Arsb G A 13: 93,862,287 G368R possibly damaging Het
Asxl3 G A 18: 22,453,605 A151T probably damaging Het
Bcas3 T C 11: 85,359,610 probably benign Het
Bmpr2 AACACA AACA 1: 59,867,580 probably null Het
Bst1 A G 5: 43,819,072 Y49C probably damaging Het
Btrc T A 19: 45,423,173 L12Q probably damaging Het
Cd248 T C 19: 5,069,023 F300L possibly damaging Het
Cdk11b G T 4: 155,641,619 probably benign Het
Cfap44 A T 16: 44,468,372 D1495V probably damaging Het
Chil3 T A 3: 106,160,478 I124F probably damaging Het
Cnot2 A T 10: 116,517,368 S63T possibly damaging Het
Cox8a G T 19: 7,215,418 H61N probably benign Het
Cpne9 T C 6: 113,300,601 V427A probably damaging Het
Ctsll3 C A 13: 60,798,595 G301C probably damaging Het
Cubn T A 2: 13,306,432 D3094V probably damaging Het
Cyba A T 8: 122,427,238 M65K possibly damaging Het
Cyp4f39 T A 17: 32,486,960 S342T possibly damaging Het
Daam2 T C 17: 49,480,778 I436V probably benign Het
Daglb T C 5: 143,474,608 probably benign Het
Dnah7b T G 1: 46,223,178 L2067R probably damaging Het
Ep300 T C 15: 81,616,127 probably null Het
Esm1 A G 13: 113,216,696 N171D probably damaging Het
Fbxl2 T C 9: 113,985,325 E266G probably damaging Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Hacd3 A T 9: 65,004,242 probably benign Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lct T C 1: 128,327,895 M137V probably benign Het
Lilr4b T G 10: 51,484,518 N176K probably benign Het
Macf1 T A 4: 123,387,397 H4340L probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mmrn1 C A 6: 60,973,010 Q315K probably damaging Het
Mon2 C A 10: 123,013,512 L1294F possibly damaging Het
Muc5ac A G 7: 141,795,275 T483A possibly damaging Het
Nacc1 T C 8: 84,674,875 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ngef A G 1: 87,540,648 probably benign Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Ogfod3 A T 11: 121,195,070 probably benign Het
Olfr1104 A C 2: 87,021,790 Y251* probably null Het
Olfr767 A T 10: 129,079,363 V200E probably damaging Het
Parpbp T C 10: 88,093,009 Y523C possibly damaging Het
Pik3cg C A 12: 32,204,322 L555F probably benign Het
Pkp3 T G 7: 141,089,763 probably null Het
Pole G T 5: 110,324,425 R1518L probably damaging Het
Prkab1 T C 5: 116,018,085 probably benign Het
Prrc2a T C 17: 35,155,820 T1285A probably benign Het
Pus1 C A 5: 110,774,854 V222L probably benign Het
Rab11fip1 A G 8: 27,143,324 L1118P probably damaging Het
Rims3 T C 4: 120,887,026 L151P probably damaging Het
Rnf130 A G 11: 50,071,219 D164G possibly damaging Het
Rps6ka2 C A 17: 7,262,186 L293I probably benign Het
Ruvbl1 A G 6: 88,484,459 T269A possibly damaging Het
Sema4a A T 3: 88,451,422 I10N probably damaging Het
Serpinb6e A T 13: 33,841,060 S83T probably benign Het
Slc12a9 C A 5: 137,315,288 W803L probably damaging Het
Slc3a2 A G 19: 8,708,073 S188P probably damaging Het
Slc7a13 G A 4: 19,818,782 probably benign Het
Spg20 A T 3: 55,127,671 K493* probably null Het
Sun1 T C 5: 139,241,411 V574A probably damaging Het
Supt6 A G 11: 78,208,236 V1603A probably benign Het
Tgm5 A G 2: 121,077,581 V38A possibly damaging Het
Tm6sf2 T C 8: 70,077,868 probably benign Het
Tnfaip2 T A 12: 111,445,858 V231E possibly damaging Het
Tube1 T A 10: 39,145,602 M281K possibly damaging Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Tyrp1 A G 4: 80,840,778 Y296C probably damaging Het
Utp4 A G 8: 106,894,669 N26S probably benign Het
Vgf T A 5: 137,031,482 probably benign Het
Zfat T C 15: 68,187,099 K196E possibly damaging Het
Zfp366 G T 13: 99,229,540 S403I probably damaging Het
Zfp462 G A 4: 55,010,529 G832R probably damaging Het
Zfp955a T A 17: 33,242,456 Q234L probably damaging Het
Zufsp T C 10: 33,943,713 T202A probably damaging Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7083:Ranbp2 UTSW 10 58479230 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
R7424:Ranbp2 UTSW 10 58479194 missense probably damaging 0.98
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCAGCAGCTCAGTTCATGCTTCTC -3'
(R):5'- GCAATTTTGCCACATGGTGACTCTC -3'

Sequencing Primer
(F):5'- GGTGAGTCCACTACAGGATTTAAC -3'
(R):5'- TCCTGTAGTTTAAAACGAACAGCC -3'
Posted On2013-04-18