Incidental Mutation 'R0145:Ep300'
ID29624
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene NameE1A binding protein p300
SynonymsKAT3B, p300
MMRRC Submission 038430-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0145 (G1) of strain 722
Quality Score138
Status Validated (trace)
Chromosome15
Chromosomal Location81585351-81652077 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 81616127 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387] [ENSMUST00000206936]
Predicted Effect probably null
Transcript: ENSMUST00000068387
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190035
Predicted Effect probably benign
Transcript: ENSMUST00000206936
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 93.7%
  • 20x: 82.1%
Validation Efficiency 96% (109/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,601,921 E64G probably damaging Het
1810043G02Rik T C 10: 77,983,556 S196P probably benign Het
4931408C20Rik A G 1: 26,687,332 M32T probably benign Het
Actr6 A T 10: 89,728,178 Y77* probably null Het
Aldoart1 A T 4: 72,851,339 S411T probably benign Het
Aqp1 C T 6: 55,346,687 R234C probably damaging Het
Arsb G A 13: 93,862,287 G368R possibly damaging Het
Asxl3 G A 18: 22,453,605 A151T probably damaging Het
Bcas3 T C 11: 85,359,610 probably benign Het
Bmpr2 AACACA AACA 1: 59,867,580 probably null Het
Bst1 A G 5: 43,819,072 Y49C probably damaging Het
Btrc T A 19: 45,423,173 L12Q probably damaging Het
Cd248 T C 19: 5,069,023 F300L possibly damaging Het
Cdk11b G T 4: 155,641,619 probably benign Het
Cfap44 A T 16: 44,468,372 D1495V probably damaging Het
Chil3 T A 3: 106,160,478 I124F probably damaging Het
Cnot2 A T 10: 116,517,368 S63T possibly damaging Het
Cox8a G T 19: 7,215,418 H61N probably benign Het
Cpne9 T C 6: 113,300,601 V427A probably damaging Het
Ctsll3 C A 13: 60,798,595 G301C probably damaging Het
Cubn T A 2: 13,306,432 D3094V probably damaging Het
Cyba A T 8: 122,427,238 M65K possibly damaging Het
Cyp4f39 T A 17: 32,486,960 S342T possibly damaging Het
Daam2 T C 17: 49,480,778 I436V probably benign Het
Daglb T C 5: 143,474,608 probably benign Het
Dnah7b T G 1: 46,223,178 L2067R probably damaging Het
Esm1 A G 13: 113,216,696 N171D probably damaging Het
Fbxl2 T C 9: 113,985,325 E266G probably damaging Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Hacd3 A T 9: 65,004,242 probably benign Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lct T C 1: 128,327,895 M137V probably benign Het
Lilr4b T G 10: 51,484,518 N176K probably benign Het
Macf1 T A 4: 123,387,397 H4340L probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mmrn1 C A 6: 60,973,010 Q315K probably damaging Het
Mon2 C A 10: 123,013,512 L1294F possibly damaging Het
Muc5ac A G 7: 141,795,275 T483A possibly damaging Het
Nacc1 T C 8: 84,674,875 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ngef A G 1: 87,540,648 probably benign Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Ogfod3 A T 11: 121,195,070 probably benign Het
Olfr1104 A C 2: 87,021,790 Y251* probably null Het
Olfr767 A T 10: 129,079,363 V200E probably damaging Het
Parpbp T C 10: 88,093,009 Y523C possibly damaging Het
Pik3cg C A 12: 32,204,322 L555F probably benign Het
Pkp3 T G 7: 141,089,763 probably null Het
Pole G T 5: 110,324,425 R1518L probably damaging Het
Prkab1 T C 5: 116,018,085 probably benign Het
Prrc2a T C 17: 35,155,820 T1285A probably benign Het
Pus1 C A 5: 110,774,854 V222L probably benign Het
Rab11fip1 A G 8: 27,143,324 L1118P probably damaging Het
Ranbp2 T A 10: 58,480,046 I2196N probably damaging Het
Rims3 T C 4: 120,887,026 L151P probably damaging Het
Rnf130 A G 11: 50,071,219 D164G possibly damaging Het
Rps6ka2 C A 17: 7,262,186 L293I probably benign Het
Ruvbl1 A G 6: 88,484,459 T269A possibly damaging Het
Sema4a A T 3: 88,451,422 I10N probably damaging Het
Serpinb6e A T 13: 33,841,060 S83T probably benign Het
Slc12a9 C A 5: 137,315,288 W803L probably damaging Het
Slc3a2 A G 19: 8,708,073 S188P probably damaging Het
Slc7a13 G A 4: 19,818,782 probably benign Het
Spg20 A T 3: 55,127,671 K493* probably null Het
Sun1 T C 5: 139,241,411 V574A probably damaging Het
Supt6 A G 11: 78,208,236 V1603A probably benign Het
Tgm5 A G 2: 121,077,581 V38A possibly damaging Het
Tm6sf2 T C 8: 70,077,868 probably benign Het
Tnfaip2 T A 12: 111,445,858 V231E possibly damaging Het
Tube1 T A 10: 39,145,602 M281K possibly damaging Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Tyrp1 A G 4: 80,840,778 Y296C probably damaging Het
Utp4 A G 8: 106,894,669 N26S probably benign Het
Vgf T A 5: 137,031,482 probably benign Het
Zfat T C 15: 68,187,099 K196E possibly damaging Het
Zfp366 G T 13: 99,229,540 S403I probably damaging Het
Zfp462 G A 4: 55,010,529 G832R probably damaging Het
Zfp955a T A 17: 33,242,456 Q234L probably damaging Het
Zufsp T C 10: 33,943,713 T202A probably damaging Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81641418 missense unknown
IGL01128:Ep300 APN 15 81630006 unclassified probably benign
IGL01151:Ep300 APN 15 81623472 intron probably benign
IGL01414:Ep300 APN 15 81627266 unclassified probably benign
IGL01564:Ep300 APN 15 81632464 unclassified probably benign
IGL01875:Ep300 APN 15 81640023 missense unknown
IGL01945:Ep300 APN 15 81616109 unclassified probably benign
IGL02022:Ep300 APN 15 81611437 unclassified probably benign
IGL02115:Ep300 APN 15 81648818 missense unknown
IGL02129:Ep300 APN 15 81586636 missense unknown
IGL02145:Ep300 APN 15 81601166 missense unknown
IGL02149:Ep300 APN 15 81628420 unclassified probably benign
IGL02165:Ep300 APN 15 81641391 missense probably benign 0.39
IGL02226:Ep300 APN 15 81613412 missense unknown
IGL02610:Ep300 APN 15 81601522 missense unknown
IGL02731:Ep300 APN 15 81648414 missense unknown
IGL03239:Ep300 APN 15 81641388 missense unknown
R0077:Ep300 UTSW 15 81641313 missense unknown
R0244:Ep300 UTSW 15 81640128 missense unknown
R0390:Ep300 UTSW 15 81640116 missense unknown
R0534:Ep300 UTSW 15 81600896 splice site probably benign
R0671:Ep300 UTSW 15 81616134 unclassified probably benign
R0840:Ep300 UTSW 15 81644933 missense unknown
R1166:Ep300 UTSW 15 81630064 unclassified probably benign
R1737:Ep300 UTSW 15 81626347 missense probably damaging 0.99
R1893:Ep300 UTSW 15 81631646 unclassified probably benign
R2136:Ep300 UTSW 15 81640447 missense unknown
R3427:Ep300 UTSW 15 81601279 missense unknown
R3757:Ep300 UTSW 15 81648589 missense unknown
R3892:Ep300 UTSW 15 81619997 unclassified probably benign
R4554:Ep300 UTSW 15 81601430 missense unknown
R4575:Ep300 UTSW 15 81649009 missense unknown
R4575:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81611410 unclassified probably benign
R5021:Ep300 UTSW 15 81640023 missense unknown
R5366:Ep300 UTSW 15 81616100 missense probably benign 0.24
R5372:Ep300 UTSW 15 81636830 missense unknown
R5393:Ep300 UTSW 15 81631618 unclassified probably benign
R5410:Ep300 UTSW 15 81648854 missense unknown
R5571:Ep300 UTSW 15 81643217 intron probably benign
R5701:Ep300 UTSW 15 81601495 missense unknown
R5772:Ep300 UTSW 15 81639914 intron probably benign
R5825:Ep300 UTSW 15 81611472 missense probably benign 0.39
R5917:Ep300 UTSW 15 81628607 unclassified probably benign
R5991:Ep300 UTSW 15 81648466 missense unknown
R6019:Ep300 UTSW 15 81641382 missense unknown
R6144:Ep300 UTSW 15 81601234 missense unknown
R6291:Ep300 UTSW 15 81648507 missense unknown
R6292:Ep300 UTSW 15 81616734 unclassified probably benign
R6599:Ep300 UTSW 15 81586713 missense unknown
R6804:Ep300 UTSW 15 81641311 nonsense probably null
R6925:Ep300 UTSW 15 81649981 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGAGTCTCTGATGACGACGACGA -3'
(R):5'- CAACACTGCAACTCCCTGCTTCT -3'

Sequencing Primer
(F):5'- atccatctgcccctgcc -3'
(R):5'- AACTCCCTGCTTCTGTACCTG -3'
Posted On2013-04-18