Incidental Mutation 'R0352:Aplf'
ID29704
Institutional Source Beutler Lab
Gene Symbol Aplf
Ensembl Gene ENSMUSG00000030051
Gene Nameaprataxin and PNKP like factor
Synonyms2010301N04Rik
MMRRC Submission 038558-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0352 (G1)
Quality Score219
Status Validated
Chromosome6
Chromosomal Location87628424-87672193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87653884 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 190 (V190I)
Ref Sequence ENSEMBL: ENSMUSP00000066232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032130] [ENSMUST00000065997] [ENSMUST00000203209]
Predicted Effect probably benign
Transcript: ENSMUST00000032130
AA Change: V211I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032130
Gene: ENSMUSG00000030051
AA Change: V211I

DomainStartEndE-ValueType
SCOP:d1lgpa_ 6 105 2e-11 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
Pfam:zf-CCHH 372 396 1.7e-16 PFAM
Pfam:zf-CCHH 414 437 6.8e-15 PFAM
low complexity region 456 471 N/A INTRINSIC
low complexity region 477 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065997
AA Change: V190I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066232
Gene: ENSMUSG00000030051
AA Change: V190I

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 84 7e-6 SMART
low complexity region 243 257 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
Pfam:zf-CCHH 351 376 1.7e-15 PFAM
Pfam:zf-CCHH 393 417 1.9e-15 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 456 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204112
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2ORF13 is a component of the cellular response to chromosomal DNA single- and double-strand breaks (Iles et al., 2007 [PubMed 17353262]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased repair of gamma irradiation-induced DNA damage and increased microhomology at class switch recombination junctions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,138,030 T64M possibly damaging Het
3110040N11Rik G T 7: 81,788,460 N49K probably benign Het
Adrb1 T A 19: 56,722,861 F164I probably damaging Het
Aqr A G 2: 114,170,052 Y50H probably damaging Het
Arfgef3 A C 10: 18,661,387 I182R probably benign Het
BC080695 A T 4: 143,571,308 probably benign Het
Cacna1b G A 2: 24,625,232 probably benign Het
Casp9 A G 4: 141,805,530 T246A probably damaging Het
Clcn6 A G 4: 148,014,606 S427P probably damaging Het
Cnga1 T C 5: 72,604,503 N556S possibly damaging Het
Cntnap2 G A 6: 45,992,084 probably null Het
Col11a2 T G 17: 34,042,527 V120G probably benign Het
Cux2 A C 5: 121,884,739 probably benign Het
Dmrt2 T C 19: 25,678,662 S542P probably damaging Het
Dnah7b A G 1: 46,277,126 H3133R probably damaging Het
Drosha G A 15: 12,837,288 R286Q unknown Het
Eipr1 A G 12: 28,766,785 D47G probably damaging Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Fras1 T G 5: 96,726,540 Y2275D probably damaging Het
Gm13083 A T 4: 143,615,989 D222V possibly damaging Het
Grm4 C T 17: 27,451,891 probably benign Het
Hebp1 A G 6: 135,152,920 V100A possibly damaging Het
Hivep2 G A 10: 14,143,295 V1937I possibly damaging Het
Hs3st6 T C 17: 24,758,194 V216A probably damaging Het
Hsd17b4 T C 18: 50,191,784 I688T probably benign Het
Hydin T C 8: 110,569,901 probably null Het
Iws1 A G 18: 32,084,205 E426G probably damaging Het
Klrb1f T C 6: 129,053,717 S64P probably damaging Het
Lacc1 C T 14: 77,035,189 G56R probably damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lipm C T 19: 34,112,875 probably benign Het
Lum A G 10: 97,568,609 H122R probably damaging Het
Magi2 A G 5: 20,065,666 Y15C probably damaging Het
Mal A T 2: 127,640,366 I39N probably damaging Het
Mgme1 A G 2: 144,276,399 H197R probably benign Het
Mmrn1 A T 6: 60,944,971 K137N probably benign Het
Myh3 T A 11: 67,090,428 C706S possibly damaging Het
Myo18b A T 5: 112,874,523 probably benign Het
Myom1 A G 17: 71,045,749 E356G possibly damaging Het
Nfib A G 4: 82,504,717 probably benign Het
Npc1l1 T C 11: 6,223,076 M788V probably benign Het
Olfr459 C T 6: 41,772,124 M58I probably damaging Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pgap1 A T 1: 54,486,458 probably benign Het
Polr1a G T 6: 71,920,763 probably benign Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prmt2 A T 10: 76,208,503 V405D possibly damaging Het
Psg26 T A 7: 18,475,256 Y409F probably benign Het
Ptges G T 2: 30,903,132 Y29* probably null Het
Ptrhd1 A G 12: 4,236,399 T97A probably benign Het
Ripk3 T A 14: 55,786,743 probably benign Het
Rnf114 A T 2: 167,511,216 I136F probably benign Het
Serinc5 A G 13: 92,707,989 probably null Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc23a2 C A 2: 132,060,796 M495I probably benign Het
Slc52a3 T A 2: 152,007,513 L360* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syt5 A G 7: 4,541,171 V290A probably benign Het
Szt2 G A 4: 118,382,593 A1931V unknown Het
Tasp1 A G 2: 139,951,458 probably null Het
Tcp10a C A 17: 7,326,406 D43E probably damaging Het
Tnfsf11 A T 14: 78,278,968 Y187N probably benign Het
Tppp2 T A 14: 51,919,350 N61K possibly damaging Het
Wwtr1 A T 3: 57,575,127 W100R probably damaging Het
Zfp623 A G 15: 75,948,584 D463G probably benign Het
Zfp990 A G 4: 145,536,604 I57M probably damaging Het
Zmat5 G A 11: 4,722,413 C10Y probably damaging Het
Other mutations in Aplf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Aplf APN 6 87668408 splice site probably benign
IGL01304:Aplf APN 6 87641900 missense possibly damaging 0.71
IGL02267:Aplf APN 6 87658964 missense probably damaging 1.00
R0294:Aplf UTSW 6 87646245 missense probably benign 0.02
R0445:Aplf UTSW 6 87663752 missense probably damaging 1.00
R0959:Aplf UTSW 6 87646083 missense probably benign 0.24
R1127:Aplf UTSW 6 87646291 missense probably benign 0.00
R1583:Aplf UTSW 6 87646033 missense probably damaging 1.00
R2878:Aplf UTSW 6 87668427 nonsense probably null
R3617:Aplf UTSW 6 87671883 missense possibly damaging 0.85
R4708:Aplf UTSW 6 87663757 missense probably damaging 1.00
R4823:Aplf UTSW 6 87646255 missense probably damaging 1.00
R4919:Aplf UTSW 6 87630064 missense possibly damaging 0.94
R4941:Aplf UTSW 6 87668423 missense probably damaging 1.00
R4941:Aplf UTSW 6 87646349 missense probably benign 0.00
R5208:Aplf UTSW 6 87642026 splice site probably null
R5575:Aplf UTSW 6 87646147 missense probably benign 0.02
R6271:Aplf UTSW 6 87646248 missense possibly damaging 0.88
R6381:Aplf UTSW 6 87658977 missense probably damaging 0.96
R6772:Aplf UTSW 6 87663799 missense possibly damaging 0.76
R6906:Aplf UTSW 6 87630086 missense possibly damaging 0.65
R6975:Aplf UTSW 6 87646086 missense probably damaging 0.98
R7015:Aplf UTSW 6 87641902 missense probably damaging 0.99
R7038:Aplf UTSW 6 87653823 nonsense probably null
R7296:Aplf UTSW 6 87646215 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAACACCCGGTCCTTCTTGGTC -3'
(R):5'- AGTGAAACAGTTACAGCGAGCACC -3'

Sequencing Primer
(F):5'- TGGTCAGCCTTTCTGCAC -3'
(R):5'- cccacaaagtcctccccc -3'
Posted On2013-04-24