Incidental Mutation 'R0352:Fam192a'
ID29710
Institutional Source Beutler Lab
Gene Symbol Fam192a
Ensembl Gene ENSMUSG00000031774
Gene Namefamily with sequence similarity 192, member A
Synonyms2310065K24Rik, 1700001O11Rik
MMRRC Submission 038558-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R0352 (G1)
Quality Score206
Status Validated
Chromosome8
Chromosomal Location94574138-94601997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94588011 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 73 (F73S)
Ref Sequence ENSEMBL: ENSMUSP00000148342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034226] [ENSMUST00000212083] [ENSMUST00000212159] [ENSMUST00000212258] [ENSMUST00000212507] [ENSMUST00000212547] [ENSMUST00000212765] [ENSMUST00000212788] [ENSMUST00000212791] [ENSMUST00000213008] [ENSMUST00000213022]
Predicted Effect probably damaging
Transcript: ENSMUST00000034226
AA Change: F73S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034226
Gene: ENSMUSG00000031774
AA Change: F73S

DomainStartEndE-ValueType
Pfam:Nefa_Nip30_N 15 116 6.4e-36 PFAM
low complexity region 172 178 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212083
AA Change: F73S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212159
AA Change: F73S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212258
AA Change: F73S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212429
Predicted Effect possibly damaging
Transcript: ENSMUST00000212507
AA Change: F73S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000212547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212696
Predicted Effect probably damaging
Transcript: ENSMUST00000212765
AA Change: F73S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212788
AA Change: F73S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212791
AA Change: F73S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000213008
AA Change: F73S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000213022
AA Change: F73S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,138,030 T64M possibly damaging Het
3110040N11Rik G T 7: 81,788,460 N49K probably benign Het
Adrb1 T A 19: 56,722,861 F164I probably damaging Het
Aplf C T 6: 87,653,884 V190I probably benign Het
Aqr A G 2: 114,170,052 Y50H probably damaging Het
Arfgef3 A C 10: 18,661,387 I182R probably benign Het
BC080695 A T 4: 143,571,308 probably benign Het
Cacna1b G A 2: 24,625,232 probably benign Het
Casp9 A G 4: 141,805,530 T246A probably damaging Het
Clcn6 A G 4: 148,014,606 S427P probably damaging Het
Cnga1 T C 5: 72,604,503 N556S possibly damaging Het
Cntnap2 G A 6: 45,992,084 probably null Het
Col11a2 T G 17: 34,042,527 V120G probably benign Het
Cux2 A C 5: 121,884,739 probably benign Het
Dmrt2 T C 19: 25,678,662 S542P probably damaging Het
Dnah7b A G 1: 46,277,126 H3133R probably damaging Het
Drosha G A 15: 12,837,288 R286Q unknown Het
Eipr1 A G 12: 28,766,785 D47G probably damaging Het
Fras1 T G 5: 96,726,540 Y2275D probably damaging Het
Gm13083 A T 4: 143,615,989 D222V possibly damaging Het
Grm4 C T 17: 27,451,891 probably benign Het
Hebp1 A G 6: 135,152,920 V100A possibly damaging Het
Hivep2 G A 10: 14,143,295 V1937I possibly damaging Het
Hs3st6 T C 17: 24,758,194 V216A probably damaging Het
Hsd17b4 T C 18: 50,191,784 I688T probably benign Het
Hydin T C 8: 110,569,901 probably null Het
Iws1 A G 18: 32,084,205 E426G probably damaging Het
Klrb1f T C 6: 129,053,717 S64P probably damaging Het
Lacc1 C T 14: 77,035,189 G56R probably damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lipm C T 19: 34,112,875 probably benign Het
Lum A G 10: 97,568,609 H122R probably damaging Het
Magi2 A G 5: 20,065,666 Y15C probably damaging Het
Mal A T 2: 127,640,366 I39N probably damaging Het
Mgme1 A G 2: 144,276,399 H197R probably benign Het
Mmrn1 A T 6: 60,944,971 K137N probably benign Het
Myh3 T A 11: 67,090,428 C706S possibly damaging Het
Myo18b A T 5: 112,874,523 probably benign Het
Myom1 A G 17: 71,045,749 E356G possibly damaging Het
Nfib A G 4: 82,504,717 probably benign Het
Npc1l1 T C 11: 6,223,076 M788V probably benign Het
Olfr459 C T 6: 41,772,124 M58I probably damaging Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pgap1 A T 1: 54,486,458 probably benign Het
Polr1a G T 6: 71,920,763 probably benign Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prmt2 A T 10: 76,208,503 V405D possibly damaging Het
Psg26 T A 7: 18,475,256 Y409F probably benign Het
Ptges G T 2: 30,903,132 Y29* probably null Het
Ptrhd1 A G 12: 4,236,399 T97A probably benign Het
Ripk3 T A 14: 55,786,743 probably benign Het
Rnf114 A T 2: 167,511,216 I136F probably benign Het
Serinc5 A G 13: 92,707,989 probably null Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc23a2 C A 2: 132,060,796 M495I probably benign Het
Slc52a3 T A 2: 152,007,513 L360* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syt5 A G 7: 4,541,171 V290A probably benign Het
Szt2 G A 4: 118,382,593 A1931V unknown Het
Tasp1 A G 2: 139,951,458 probably null Het
Tcp10a C A 17: 7,326,406 D43E probably damaging Het
Tnfsf11 A T 14: 78,278,968 Y187N probably benign Het
Tppp2 T A 14: 51,919,350 N61K possibly damaging Het
Wwtr1 A T 3: 57,575,127 W100R probably damaging Het
Zfp623 A G 15: 75,948,584 D463G probably benign Het
Zfp990 A G 4: 145,536,604 I57M probably damaging Het
Zmat5 G A 11: 4,722,413 C10Y probably damaging Het
Other mutations in Fam192a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Fam192a APN 8 94587362 missense probably damaging 1.00
IGL01993:Fam192a APN 8 94575752 missense possibly damaging 0.78
IGL02483:Fam192a APN 8 94588766 splice site probably benign
R0206:Fam192a UTSW 8 94588011 missense probably damaging 1.00
R0885:Fam192a UTSW 8 94575779 missense probably damaging 1.00
R1777:Fam192a UTSW 8 94588811 missense probably damaging 1.00
R6193:Fam192a UTSW 8 94575720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGCATCAAGTCAAAGCATTTCTC -3'
(R):5'- TGTCTTTGAAAACCGCCTGCCC -3'

Sequencing Primer
(F):5'- TCTTAAGCTCTAAGTCAGAAGGAAG -3'
(R):5'- CCCTTCTGTATGAGGTGCAAAG -3'
Posted On2013-04-24