Incidental Mutation 'R0352:Col11a2'
ID29732
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Namecollagen, type XI, alpha 2
Synonyms
MMRRC Submission 038558-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R0352 (G1)
Quality Score224
Status Validated
Chromosome17
Chromosomal Location34039437-34066685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34042527 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 120 (V120G)
Ref Sequence ENSEMBL: ENSMUSP00000122082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044858] [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000116612] [ENSMUST00000131134] [ENSMUST00000173354]
Predicted Effect probably benign
Transcript: ENSMUST00000044858
SMART Domains Protein: ENSMUSP00000036585
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
low complexity region 66 85 N/A INTRINSIC
low complexity region 94 121 N/A INTRINSIC
low complexity region 124 147 N/A INTRINSIC
low complexity region 179 186 N/A INTRINSIC
ZnF_C4 189 260 3.98e-39 SMART
low complexity region 269 282 N/A INTRINSIC
low complexity region 305 316 N/A INTRINSIC
HOLI 328 491 1.91e-50 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087497
AA Change: V120G
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: V120G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114252
AA Change: V120G
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: V120G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114255
AA Change: V120G
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: V120G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116612
SMART Domains Protein: ENSMUSP00000112311
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 377 1.35e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131134
AA Change: V120G

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330
AA Change: V120G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173354
SMART Domains Protein: ENSMUSP00000133661
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 381 1.91e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174299
SMART Domains Protein: ENSMUSP00000133775
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 52 N/A INTRINSIC
low complexity region 55 78 N/A INTRINSIC
low complexity region 110 117 N/A INTRINSIC
ZnF_C4 120 191 3.98e-39 SMART
low complexity region 200 213 N/A INTRINSIC
low complexity region 236 247 N/A INTRINSIC
HOLI 259 418 1.35e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174578
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,138,030 T64M possibly damaging Het
3110040N11Rik G T 7: 81,788,460 N49K probably benign Het
Adrb1 T A 19: 56,722,861 F164I probably damaging Het
Aplf C T 6: 87,653,884 V190I probably benign Het
Aqr A G 2: 114,170,052 Y50H probably damaging Het
Arfgef3 A C 10: 18,661,387 I182R probably benign Het
BC080695 A T 4: 143,571,308 probably benign Het
Cacna1b G A 2: 24,625,232 probably benign Het
Casp9 A G 4: 141,805,530 T246A probably damaging Het
Clcn6 A G 4: 148,014,606 S427P probably damaging Het
Cnga1 T C 5: 72,604,503 N556S possibly damaging Het
Cntnap2 G A 6: 45,992,084 probably null Het
Cux2 A C 5: 121,884,739 probably benign Het
Dmrt2 T C 19: 25,678,662 S542P probably damaging Het
Dnah7b A G 1: 46,277,126 H3133R probably damaging Het
Drosha G A 15: 12,837,288 R286Q unknown Het
Eipr1 A G 12: 28,766,785 D47G probably damaging Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Fras1 T G 5: 96,726,540 Y2275D probably damaging Het
Gm13083 A T 4: 143,615,989 D222V possibly damaging Het
Grm4 C T 17: 27,451,891 probably benign Het
Hebp1 A G 6: 135,152,920 V100A possibly damaging Het
Hivep2 G A 10: 14,143,295 V1937I possibly damaging Het
Hs3st6 T C 17: 24,758,194 V216A probably damaging Het
Hsd17b4 T C 18: 50,191,784 I688T probably benign Het
Hydin T C 8: 110,569,901 probably null Het
Iws1 A G 18: 32,084,205 E426G probably damaging Het
Klrb1f T C 6: 129,053,717 S64P probably damaging Het
Lacc1 C T 14: 77,035,189 G56R probably damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lipm C T 19: 34,112,875 probably benign Het
Lum A G 10: 97,568,609 H122R probably damaging Het
Magi2 A G 5: 20,065,666 Y15C probably damaging Het
Mal A T 2: 127,640,366 I39N probably damaging Het
Mgme1 A G 2: 144,276,399 H197R probably benign Het
Mmrn1 A T 6: 60,944,971 K137N probably benign Het
Myh3 T A 11: 67,090,428 C706S possibly damaging Het
Myo18b A T 5: 112,874,523 probably benign Het
Myom1 A G 17: 71,045,749 E356G possibly damaging Het
Nfib A G 4: 82,504,717 probably benign Het
Npc1l1 T C 11: 6,223,076 M788V probably benign Het
Olfr459 C T 6: 41,772,124 M58I probably damaging Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pgap1 A T 1: 54,486,458 probably benign Het
Polr1a G T 6: 71,920,763 probably benign Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prmt2 A T 10: 76,208,503 V405D possibly damaging Het
Psg26 T A 7: 18,475,256 Y409F probably benign Het
Ptges G T 2: 30,903,132 Y29* probably null Het
Ptrhd1 A G 12: 4,236,399 T97A probably benign Het
Ripk3 T A 14: 55,786,743 probably benign Het
Rnf114 A T 2: 167,511,216 I136F probably benign Het
Serinc5 A G 13: 92,707,989 probably null Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc23a2 C A 2: 132,060,796 M495I probably benign Het
Slc52a3 T A 2: 152,007,513 L360* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syt5 A G 7: 4,541,171 V290A probably benign Het
Szt2 G A 4: 118,382,593 A1931V unknown Het
Tasp1 A G 2: 139,951,458 probably null Het
Tcp10a C A 17: 7,326,406 D43E probably damaging Het
Tnfsf11 A T 14: 78,278,968 Y187N probably benign Het
Tppp2 T A 14: 51,919,350 N61K possibly damaging Het
Wwtr1 A T 3: 57,575,127 W100R probably damaging Het
Zfp623 A G 15: 75,948,584 D463G probably benign Het
Zfp990 A G 4: 145,536,604 I57M probably damaging Het
Zmat5 G A 11: 4,722,413 C10Y probably damaging Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34061280 unclassified probably benign
IGL01839:Col11a2 APN 17 34064082 unclassified probably benign
IGL02429:Col11a2 APN 17 34042292 missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34064207 unclassified probably benign
R0001:Col11a2 UTSW 17 34061612 missense probably benign 0.00
R0005:Col11a2 UTSW 17 34062879 unclassified probably benign
R0099:Col11a2 UTSW 17 34049674 missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34062546 unclassified probably benign
R0254:Col11a2 UTSW 17 34064803 unclassified probably benign
R0362:Col11a2 UTSW 17 34062446 splice site probably null
R0491:Col11a2 UTSW 17 34042212 missense probably null 0.00
R0531:Col11a2 UTSW 17 34058377 splice site probably benign
R0538:Col11a2 UTSW 17 34051328 splice site probably benign
R0646:Col11a2 UTSW 17 34059348 critical splice donor site probably null
R0676:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34059150 missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34055254 missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34063895 unclassified probably benign
R1872:Col11a2 UTSW 17 34062555 unclassified probably benign
R1941:Col11a2 UTSW 17 34044951 missense probably benign 0.01
R1945:Col11a2 UTSW 17 34059168 missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34052169 missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34064797 unclassified probably benign
R2258:Col11a2 UTSW 17 34039677 missense probably benign
R2259:Col11a2 UTSW 17 34039677 missense probably benign
R2260:Col11a2 UTSW 17 34039677 missense probably benign
R2761:Col11a2 UTSW 17 34051026 missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34046468 missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34054180 missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34039625 unclassified probably benign
R4039:Col11a2 UTSW 17 34045774 missense probably benign 0.00
R4675:Col11a2 UTSW 17 34064293 critical splice donor site probably null
R4810:Col11a2 UTSW 17 34057112 missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34050963 missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34042190 missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34064088 unclassified probably benign
R5355:Col11a2 UTSW 17 34051801 missense probably benign 0.07
R5384:Col11a2 UTSW 17 34059174 critical splice donor site probably null
R5534:Col11a2 UTSW 17 34051024 missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34064185 unclassified probably benign
R6252:Col11a2 UTSW 17 34042212 missense probably null 0.00
R6327:Col11a2 UTSW 17 34043317 missense probably benign 0.32
R6828:Col11a2 UTSW 17 34053633 splice site probably null
R6860:Col11a2 UTSW 17 34053598 missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34065019 missense unknown
X0017:Col11a2 UTSW 17 34059985 critical splice donor site probably null
X0064:Col11a2 UTSW 17 34042247 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCCGATGGTGTTCGGAGATCAAAAG -3'
(R):5'- CAAGTGTGCCCAAAGGTCCAGTAG -3'

Sequencing Primer
(F):5'- ATCAAAAGGGGTCTGTCCG -3'
(R):5'- CCAGTAGAGGTCCTCAGTTTAG -3'
Posted On2013-04-24