Incidental Mutation 'R0352:Myom1'
ID29733
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
MMRRC Submission 038558-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R0352 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71045749 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 356 (E356G)
Ref Sequence ENSEMBL: ENSMUSP00000024847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: E356G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: E356G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: E356G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: E356G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: E356G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: E356G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,138,030 T64M possibly damaging Het
3110040N11Rik G T 7: 81,788,460 N49K probably benign Het
Adrb1 T A 19: 56,722,861 F164I probably damaging Het
Aplf C T 6: 87,653,884 V190I probably benign Het
Aqr A G 2: 114,170,052 Y50H probably damaging Het
Arfgef3 A C 10: 18,661,387 I182R probably benign Het
BC080695 A T 4: 143,571,308 probably benign Het
Cacna1b G A 2: 24,625,232 probably benign Het
Casp9 A G 4: 141,805,530 T246A probably damaging Het
Clcn6 A G 4: 148,014,606 S427P probably damaging Het
Cnga1 T C 5: 72,604,503 N556S possibly damaging Het
Cntnap2 G A 6: 45,992,084 probably null Het
Col11a2 T G 17: 34,042,527 V120G probably benign Het
Cux2 A C 5: 121,884,739 probably benign Het
Dmrt2 T C 19: 25,678,662 S542P probably damaging Het
Dnah7b A G 1: 46,277,126 H3133R probably damaging Het
Drosha G A 15: 12,837,288 R286Q unknown Het
Eipr1 A G 12: 28,766,785 D47G probably damaging Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Fras1 T G 5: 96,726,540 Y2275D probably damaging Het
Gm13083 A T 4: 143,615,989 D222V possibly damaging Het
Grm4 C T 17: 27,451,891 probably benign Het
Hebp1 A G 6: 135,152,920 V100A possibly damaging Het
Hivep2 G A 10: 14,143,295 V1937I possibly damaging Het
Hs3st6 T C 17: 24,758,194 V216A probably damaging Het
Hsd17b4 T C 18: 50,191,784 I688T probably benign Het
Hydin T C 8: 110,569,901 probably null Het
Iws1 A G 18: 32,084,205 E426G probably damaging Het
Klrb1f T C 6: 129,053,717 S64P probably damaging Het
Lacc1 C T 14: 77,035,189 G56R probably damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lipm C T 19: 34,112,875 probably benign Het
Lum A G 10: 97,568,609 H122R probably damaging Het
Magi2 A G 5: 20,065,666 Y15C probably damaging Het
Mal A T 2: 127,640,366 I39N probably damaging Het
Mgme1 A G 2: 144,276,399 H197R probably benign Het
Mmrn1 A T 6: 60,944,971 K137N probably benign Het
Myh3 T A 11: 67,090,428 C706S possibly damaging Het
Myo18b A T 5: 112,874,523 probably benign Het
Nfib A G 4: 82,504,717 probably benign Het
Npc1l1 T C 11: 6,223,076 M788V probably benign Het
Olfr459 C T 6: 41,772,124 M58I probably damaging Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pgap1 A T 1: 54,486,458 probably benign Het
Polr1a G T 6: 71,920,763 probably benign Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prmt2 A T 10: 76,208,503 V405D possibly damaging Het
Psg26 T A 7: 18,475,256 Y409F probably benign Het
Ptges G T 2: 30,903,132 Y29* probably null Het
Ptrhd1 A G 12: 4,236,399 T97A probably benign Het
Ripk3 T A 14: 55,786,743 probably benign Het
Rnf114 A T 2: 167,511,216 I136F probably benign Het
Serinc5 A G 13: 92,707,989 probably null Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc23a2 C A 2: 132,060,796 M495I probably benign Het
Slc52a3 T A 2: 152,007,513 L360* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syt5 A G 7: 4,541,171 V290A probably benign Het
Szt2 G A 4: 118,382,593 A1931V unknown Het
Tasp1 A G 2: 139,951,458 probably null Het
Tcp10a C A 17: 7,326,406 D43E probably damaging Het
Tnfsf11 A T 14: 78,278,968 Y187N probably benign Het
Tppp2 T A 14: 51,919,350 N61K possibly damaging Het
Wwtr1 A T 3: 57,575,127 W100R probably damaging Het
Zfp623 A G 15: 75,948,584 D463G probably benign Het
Zfp990 A G 4: 145,536,604 I57M probably damaging Het
Zmat5 G A 11: 4,722,413 C10Y probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 intron probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 intron probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CAGCCAACTGTTACAAGGGGTCAC -3'
(R):5'- TGTCGCTTCCTTAAACGCCAGG -3'

Sequencing Primer
(F):5'- TTTGAAGACACAGCTCAGTACCG -3'
(R):5'- TTCCTTAAACGCCAGGATTCAG -3'
Posted On2013-04-24