Incidental Mutation 'R0352:Dmrt2'
ID29736
Institutional Source Beutler Lab
Gene Symbol Dmrt2
Ensembl Gene ENSMUSG00000048138
Gene Namedoublesex and mab-3 related transcription factor 2
SynonymsTerra
MMRRC Submission 038558-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0352 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location25672420-25679010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25678662 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 542 (S542P)
Ref Sequence ENSEMBL: ENSMUSP00000059654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053068]
Predicted Effect probably damaging
Transcript: ENSMUST00000053068
AA Change: S542P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059654
Gene: ENSMUSG00000048138
AA Change: S542P

DomainStartEndE-ValueType
low complexity region 38 74 N/A INTRINSIC
low complexity region 78 115 N/A INTRINSIC
DM 119 172 5.2e-28 SMART
low complexity region 224 229 N/A INTRINSIC
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DMRT gene family, sharing a DM DNA-binding domain with Drosophila 'doublesex' (dsx) and C. elegans mab3, genes involved in sex determination in these organisms. Also, this gene is located in a region of the human genome (chromosome 9p24.3) associated with gonadal dysgenesis and XY sex reversal. Hence this gene is one of the candidates for sex-determining gene(s) on chr 9. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display perinatal lethality due to breathing difficulties, multiple axial skeletal defects including kinked tails and rib and vertebral malformations, and abnormal somite organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,138,030 T64M possibly damaging Het
3110040N11Rik G T 7: 81,788,460 N49K probably benign Het
Adrb1 T A 19: 56,722,861 F164I probably damaging Het
Aplf C T 6: 87,653,884 V190I probably benign Het
Aqr A G 2: 114,170,052 Y50H probably damaging Het
Arfgef3 A C 10: 18,661,387 I182R probably benign Het
BC080695 A T 4: 143,571,308 probably benign Het
Cacna1b G A 2: 24,625,232 probably benign Het
Casp9 A G 4: 141,805,530 T246A probably damaging Het
Clcn6 A G 4: 148,014,606 S427P probably damaging Het
Cnga1 T C 5: 72,604,503 N556S possibly damaging Het
Cntnap2 G A 6: 45,992,084 probably null Het
Col11a2 T G 17: 34,042,527 V120G probably benign Het
Cux2 A C 5: 121,884,739 probably benign Het
Dnah7b A G 1: 46,277,126 H3133R probably damaging Het
Drosha G A 15: 12,837,288 R286Q unknown Het
Eipr1 A G 12: 28,766,785 D47G probably damaging Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Fras1 T G 5: 96,726,540 Y2275D probably damaging Het
Gm13083 A T 4: 143,615,989 D222V possibly damaging Het
Grm4 C T 17: 27,451,891 probably benign Het
Hebp1 A G 6: 135,152,920 V100A possibly damaging Het
Hivep2 G A 10: 14,143,295 V1937I possibly damaging Het
Hs3st6 T C 17: 24,758,194 V216A probably damaging Het
Hsd17b4 T C 18: 50,191,784 I688T probably benign Het
Hydin T C 8: 110,569,901 probably null Het
Iws1 A G 18: 32,084,205 E426G probably damaging Het
Klrb1f T C 6: 129,053,717 S64P probably damaging Het
Lacc1 C T 14: 77,035,189 G56R probably damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lipm C T 19: 34,112,875 probably benign Het
Lum A G 10: 97,568,609 H122R probably damaging Het
Magi2 A G 5: 20,065,666 Y15C probably damaging Het
Mal A T 2: 127,640,366 I39N probably damaging Het
Mgme1 A G 2: 144,276,399 H197R probably benign Het
Mmrn1 A T 6: 60,944,971 K137N probably benign Het
Myh3 T A 11: 67,090,428 C706S possibly damaging Het
Myo18b A T 5: 112,874,523 probably benign Het
Myom1 A G 17: 71,045,749 E356G possibly damaging Het
Nfib A G 4: 82,504,717 probably benign Het
Npc1l1 T C 11: 6,223,076 M788V probably benign Het
Olfr459 C T 6: 41,772,124 M58I probably damaging Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pgap1 A T 1: 54,486,458 probably benign Het
Polr1a G T 6: 71,920,763 probably benign Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prmt2 A T 10: 76,208,503 V405D possibly damaging Het
Psg26 T A 7: 18,475,256 Y409F probably benign Het
Ptges G T 2: 30,903,132 Y29* probably null Het
Ptrhd1 A G 12: 4,236,399 T97A probably benign Het
Ripk3 T A 14: 55,786,743 probably benign Het
Rnf114 A T 2: 167,511,216 I136F probably benign Het
Serinc5 A G 13: 92,707,989 probably null Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc23a2 C A 2: 132,060,796 M495I probably benign Het
Slc52a3 T A 2: 152,007,513 L360* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syt5 A G 7: 4,541,171 V290A probably benign Het
Szt2 G A 4: 118,382,593 A1931V unknown Het
Tasp1 A G 2: 139,951,458 probably null Het
Tcp10a C A 17: 7,326,406 D43E probably damaging Het
Tnfsf11 A T 14: 78,278,968 Y187N probably benign Het
Tppp2 T A 14: 51,919,350 N61K possibly damaging Het
Wwtr1 A T 3: 57,575,127 W100R probably damaging Het
Zfp623 A G 15: 75,948,584 D463G probably benign Het
Zfp990 A G 4: 145,536,604 I57M probably damaging Het
Zmat5 G A 11: 4,722,413 C10Y probably damaging Het
Other mutations in Dmrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmrt2 APN 19 25678134 missense probably damaging 1.00
IGL02269:Dmrt2 APN 19 25678459 missense probably benign 0.01
IGL02740:Dmrt2 APN 19 25678473 missense possibly damaging 0.84
R0141:Dmrt2 UTSW 19 25678291 missense possibly damaging 0.52
R0294:Dmrt2 UTSW 19 25678071 missense probably damaging 1.00
R0514:Dmrt2 UTSW 19 25675655 critical splice donor site probably null
R1016:Dmrt2 UTSW 19 25675574 missense probably damaging 0.99
R1104:Dmrt2 UTSW 19 25678616 missense probably benign 0.01
R1164:Dmrt2 UTSW 19 25677993 missense possibly damaging 0.89
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R3107:Dmrt2 UTSW 19 25677691 missense probably benign 0.01
R3109:Dmrt2 UTSW 19 25677691 missense probably benign 0.01
R4029:Dmrt2 UTSW 19 25678134 missense probably damaging 0.99
R4841:Dmrt2 UTSW 19 25677667 missense probably damaging 1.00
R5317:Dmrt2 UTSW 19 25673480 missense probably benign 0.00
R6335:Dmrt2 UTSW 19 25673571 missense possibly damaging 0.73
R6554:Dmrt2 UTSW 19 25677948 missense probably damaging 1.00
R6752:Dmrt2 UTSW 19 25678342 missense probably damaging 0.96
X0058:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0060:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0063:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
Z1088:Dmrt2 UTSW 19 25678642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAGTTGAACGCACCATTTGTC -3'
(R):5'- GCACAGACCCTTACAATTTGCACAG -3'

Sequencing Primer
(F):5'- TGAACGCACCATTTGTCAAAGAAG -3'
(R):5'- AGCAGCCCTTTACTGAGAGA -3'
Posted On2013-04-24