Incidental Mutation 'R0355:Lrrc40'
ID29743
Institutional Source Beutler Lab
Gene Symbol Lrrc40
Ensembl Gene ENSMUSG00000063052
Gene Nameleucine rich repeat containing 40
Synonyms2610040E16Rik
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0355 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location158036662-158068487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158040471 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 61 (D61V)
Ref Sequence ENSEMBL: ENSMUSP00000116475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069025] [ENSMUST00000072080] [ENSMUST00000121326] [ENSMUST00000126716] [ENSMUST00000137444] [ENSMUST00000150525] [ENSMUST00000156597] [ENSMUST00000200540]
Predicted Effect probably benign
Transcript: ENSMUST00000069025
SMART Domains Protein: ENSMUSP00000063916
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 271 310 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
low complexity region 365 374 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072080
AA Change: D61V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071956
Gene: ENSMUSG00000063052
AA Change: D61V

DomainStartEndE-ValueType
LRR 81 100 7.11e1 SMART
LRR 104 126 6.13e-1 SMART
LRR 127 149 1.51e0 SMART
LRR_TYP 150 172 8.47e-4 SMART
LRR 173 195 3.52e-1 SMART
LRR_TYP 196 219 2.91e-2 SMART
LRR 242 261 9.15e0 SMART
LRR 265 287 1.01e2 SMART
LRR 288 310 1.86e1 SMART
LRR 311 334 2.32e-1 SMART
LRR 335 356 2.21e2 SMART
LRR 471 493 1.86e0 SMART
LRR 494 517 8.97e0 SMART
LRR 541 564 1.53e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089922
Predicted Effect probably benign
Transcript: ENSMUST00000121326
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123028
AA Change: D16V

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121905
Gene: ENSMUSG00000063052
AA Change: D16V

DomainStartEndE-ValueType
SCOP:d1fqva2 37 68 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126716
SMART Domains Protein: ENSMUSP00000114370
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131518
AA Change: D62V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121417
Gene: ENSMUSG00000063052
AA Change: D62V

DomainStartEndE-ValueType
SCOP:d1fqva2 80 110 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133090
Predicted Effect probably benign
Transcript: ENSMUST00000137444
SMART Domains Protein: ENSMUSP00000122686
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150525
AA Change: D61V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116475
Gene: ENSMUSG00000063052
AA Change: D61V

DomainStartEndE-ValueType
SCOP:d1fqva2 81 111 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198192
Predicted Effect probably benign
Transcript: ENSMUST00000200540
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Lrrc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Lrrc40 APN 3 158048450 missense probably damaging 1.00
IGL00501:Lrrc40 APN 3 158061282 missense probably damaging 0.96
IGL00727:Lrrc40 APN 3 158063871 critical splice donor site probably null
IGL01349:Lrrc40 APN 3 158058665 splice site probably benign
IGL02377:Lrrc40 APN 3 158036728 start codon destroyed probably null 1.00
IGL02490:Lrrc40 APN 3 158062699 missense probably damaging 1.00
IGL02657:Lrrc40 APN 3 158036773 missense probably damaging 1.00
IGL02879:Lrrc40 APN 3 158041665 intron probably benign
IGL02944:Lrrc40 APN 3 158041665 intron probably benign
IGL02954:Lrrc40 APN 3 158041665 intron probably benign
IGL02966:Lrrc40 APN 3 158041665 intron probably benign
IGL03004:Lrrc40 APN 3 158041665 intron probably benign
IGL03032:Lrrc40 APN 3 158041665 intron probably benign
IGL03112:Lrrc40 APN 3 158041665 intron probably benign
IGL03163:Lrrc40 APN 3 158041587 missense possibly damaging 0.82
I2288:Lrrc40 UTSW 3 158052789 missense probably damaging 1.00
R0266:Lrrc40 UTSW 3 158041661 critical splice donor site probably null
R0457:Lrrc40 UTSW 3 158054564 intron probably null
R0968:Lrrc40 UTSW 3 158036789 missense probably damaging 1.00
R1799:Lrrc40 UTSW 3 158036804 missense probably benign 0.38
R1962:Lrrc40 UTSW 3 158040449 missense probably benign 0.01
R4614:Lrrc40 UTSW 3 158054634 missense probably damaging 1.00
R4825:Lrrc40 UTSW 3 158061330 nonsense probably null
R4857:Lrrc40 UTSW 3 158066229 utr 3 prime probably benign
R4947:Lrrc40 UTSW 3 158063835 missense probably benign 0.00
R5148:Lrrc40 UTSW 3 158054569 splice site probably null
R5673:Lrrc40 UTSW 3 158048398 splice site probably null
R6354:Lrrc40 UTSW 3 158061264 nonsense probably null
R6382:Lrrc40 UTSW 3 158058696 missense probably damaging 0.98
R6713:Lrrc40 UTSW 3 158063713 missense probably benign 0.00
R7081:Lrrc40 UTSW 3 158036805 missense probably damaging 0.98
R7098:Lrrc40 UTSW 3 158041639 missense probably benign 0.29
V1662:Lrrc40 UTSW 3 158052789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGGAGTTACTTGGGACCATTG -3'
(R):5'- TCTGTGGACATAGAGACATGGAGCC -3'

Sequencing Primer
(F):5'- TGGGACCATTGTAAGATAAAGTATTC -3'
(R):5'- ATGGAGCCGATCTTCCAAGTC -3'
Posted On2013-04-24