Incidental Mutation 'R0355:Ints2'
ID29783
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R0355 (G1)
Quality Score222
Status Validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86234749 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 542 (T542A)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: T542A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T542A

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: T542A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T542A

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146421
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTTCAAGACCAGCTTGCATTTGTTTGAT -3'
(R):5'- ATTGTTCATCCTCGTGGACTGCATT -3'

Sequencing Primer
(F):5'- cacctctccagcccTGAAC -3'
(R):5'- GACTGCATTTAAGTGTTGATGGT -3'
Posted On2013-04-24