Incidental Mutation 'R0356:Mmp3'
ID29827
Institutional Source Beutler Lab
Gene Symbol Mmp3
Ensembl Gene ENSMUSG00000043613
Gene Namematrix metallopeptidase 3
SynonymsStmy1, Str1, stromelysin 1, SLN-1, stromelysin-1, STR-1, progelatinase, SLN1
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7445822-7455975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7451768 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 369 (E369K)
Ref Sequence ENSEMBL: ENSMUSP00000034497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034497]
Predicted Effect probably benign
Transcript: ENSMUST00000034497
AA Change: E369K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034497
Gene: ENSMUSG00000043613
AA Change: E369K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 29 89 1.7e-12 PFAM
ZnMc 107 267 6.24e-65 SMART
HX 298 340 4.56e-9 SMART
HX 342 385 2.87e-6 SMART
HX 390 437 4.73e-16 SMART
HX 439 479 3.3e-6 SMART
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded protein is activated by the removal of an N-temrinal activation peptide to generate a zinc-dependent endopeptidase with a broad range of substrates such as proteoglycans, laminin, fibronectin, elastin, and collagens. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disrutptions in this gene display abnormalities of the immune system as well as minor structural abnormalities in the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Mmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mmp3 APN 9 7445894 utr 5 prime probably benign
IGL01738:Mmp3 APN 9 7446946 missense possibly damaging 0.94
IGL02154:Mmp3 APN 9 7453662 missense probably benign 0.19
IGL02212:Mmp3 APN 9 7450165 missense probably damaging 1.00
IGL02568:Mmp3 APN 9 7446001 missense probably benign 0.02
IGL03366:Mmp3 APN 9 7450149 missense probably benign 0.00
R0047:Mmp3 UTSW 9 7451910 splice site probably benign
R0047:Mmp3 UTSW 9 7451910 splice site probably benign
R0390:Mmp3 UTSW 9 7451320 missense probably benign 0.29
R0401:Mmp3 UTSW 9 7449790 missense probably damaging 1.00
R0466:Mmp3 UTSW 9 7450165 missense probably damaging 1.00
R0549:Mmp3 UTSW 9 7455638 missense probably benign 0.08
R0903:Mmp3 UTSW 9 7445994 missense probably benign 0.00
R1438:Mmp3 UTSW 9 7453705 missense probably benign 0.22
R1498:Mmp3 UTSW 9 7446967 missense possibly damaging 0.95
R1515:Mmp3 UTSW 9 7451232 missense probably benign 0.01
R1629:Mmp3 UTSW 9 7447641 missense probably benign 0.00
R1844:Mmp3 UTSW 9 7453662 missense probably benign 0.19
R1858:Mmp3 UTSW 9 7451799 missense probably benign 0.08
R2099:Mmp3 UTSW 9 7453672 missense probably benign 0.01
R2497:Mmp3 UTSW 9 7450131 missense probably benign 0.00
R2571:Mmp3 UTSW 9 7451844 missense possibly damaging 0.95
R4659:Mmp3 UTSW 9 7453673 missense probably benign 0.00
R4687:Mmp3 UTSW 9 7451223 missense probably benign 0.03
R4717:Mmp3 UTSW 9 7449881 missense possibly damaging 0.94
R4930:Mmp3 UTSW 9 7447640 missense probably benign 0.02
R4932:Mmp3 UTSW 9 7446994 missense probably benign 0.00
R5020:Mmp3 UTSW 9 7445984 missense probably benign
R5384:Mmp3 UTSW 9 7451759 nonsense probably null
R5385:Mmp3 UTSW 9 7451759 nonsense probably null
R5408:Mmp3 UTSW 9 7449904 missense probably damaging 0.98
R6268:Mmp3 UTSW 9 7447622 missense possibly damaging 0.78
X0022:Mmp3 UTSW 9 7449857 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTGGCGCAAATCTCTCAGGACTC -3'
(R):5'- GCTGCTGCTGTTTAAAAGCCCTTC -3'

Sequencing Primer
(F):5'- ACTTAGTGAGACAAGCCTCTG -3'
(R):5'- TCCCATAGTTGCCAGAGGGAG -3'
Posted On2013-04-24