Incidental Mutation 'R0357:Cdh4'
ID29855
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Namecadherin 4
SynonymsR-Cadh, Rcad, R-cadherin
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0357 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location179442431-179899373 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 179847340 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 282 (S282P)
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314] [ENSMUST00000108911]
Predicted Effect probably damaging
Transcript: ENSMUST00000000314
AA Change: S282P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: S282P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108911
AA Change: S282P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104539
Gene: ENSMUSG00000000305
AA Change: S282P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179874144 missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179780403 missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179890884 missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179780474 missense probably benign 0.01
R0082:Cdh4 UTSW 2 179894188 missense possibly damaging 0.75
R1521:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R1591:Cdh4 UTSW 2 179886864 critical splice donor site probably null
R1622:Cdh4 UTSW 2 179889092 missense possibly damaging 0.56
R1762:Cdh4 UTSW 2 179797480 missense probably benign 0.01
R1794:Cdh4 UTSW 2 179886842 missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179890847 missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179797524 missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179780367 missense probably benign 0.09
R3861:Cdh4 UTSW 2 179874097 missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179889173 missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179780389 missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179780467 missense probably benign 0.03
R4893:Cdh4 UTSW 2 179847419 intron probably benign
R5029:Cdh4 UTSW 2 179881949 missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179886763 missense probably benign
R5542:Cdh4 UTSW 2 179860226 missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179885996 missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179895767 missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179797626 missense probably damaging 1.00
R6338:Cdh4 UTSW 2 179890812 missense probably damaging 1.00
R6589:Cdh4 UTSW 2 179881996 critical splice donor site probably null
R6607:Cdh4 UTSW 2 179874096 missense probably benign 0.00
R6653:Cdh4 UTSW 2 179780428 missense probably benign 0.34
R6711:Cdh4 UTSW 2 179890931 missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179847387 missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179860194 missense probably benign 0.19
R6981:Cdh4 UTSW 2 179797504 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CCACATCAGAGAAAAGTGTCCGTCC -3'
(R):5'- TCTCCTCCTGCATCTGAGGTTTGAG -3'

Sequencing Primer
(F):5'- AAGTGTCCGTCCCCCCTAC -3'
(R):5'- AGCTCCATAAGCCTATTCTCTG -3'
Posted On2013-04-24