Incidental Mutation 'R0357:Mtus1'
ID29885
Institutional Source Beutler Lab
Gene Symbol Mtus1
Ensembl Gene ENSMUSG00000045636
Gene Namemitochondrial tumor suppressor 1
SynonymsB430305I03Rik, MD44, MTSG1, Atip1
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R0357 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40990914-41133726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41083526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 384 (S384R)
Ref Sequence ENSEMBL: ENSMUSP00000112626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059115] [ENSMUST00000118835] [ENSMUST00000145860] [ENSMUST00000155055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059115
AA Change: S384R

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059503
Gene: ENSMUSG00000045636
AA Change: S384R

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118835
AA Change: S384R

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112626
Gene: ENSMUSG00000045636
AA Change: S384R

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143853
Predicted Effect probably benign
Transcript: ENSMUST00000145860
AA Change: S384R

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119440
Gene: ENSMUSG00000045636
AA Change: S384R

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155055
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit spontaneous heart hypertrophy and SLE-like lymphoproliferative disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Mtus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mtus1 APN 8 41084349 missense probably damaging 1.00
IGL01377:Mtus1 APN 8 41083135 missense possibly damaging 0.94
IGL01472:Mtus1 APN 8 41002412 missense probably benign 0.01
IGL01995:Mtus1 APN 8 41084420 missense probably damaging 1.00
IGL02027:Mtus1 APN 8 40993601 missense probably damaging 1.00
IGL02381:Mtus1 APN 8 41083119 missense probably benign 0.05
IGL02571:Mtus1 APN 8 41083482 missense possibly damaging 0.90
IGL02936:Mtus1 APN 8 40999517 missense possibly damaging 0.79
R0116:Mtus1 UTSW 8 40998477 unclassified probably benign
R0139:Mtus1 UTSW 8 41016196 splice site probably benign
R0178:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0179:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0220:Mtus1 UTSW 8 40994572 missense probably damaging 1.00
R0324:Mtus1 UTSW 8 41084395 missense probably benign
R0355:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R0464:Mtus1 UTSW 8 41002474 missense probably damaging 0.96
R0681:Mtus1 UTSW 8 40993517 missense probably damaging 1.00
R1016:Mtus1 UTSW 8 41050026 missense probably benign 0.43
R1570:Mtus1 UTSW 8 41076241 missense probably damaging 1.00
R1579:Mtus1 UTSW 8 41082858 missense probably damaging 1.00
R1607:Mtus1 UTSW 8 41015409 missense possibly damaging 0.58
R1869:Mtus1 UTSW 8 41076230 critical splice donor site probably null
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1891:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1894:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R2063:Mtus1 UTSW 8 41082708 missense probably damaging 1.00
R2111:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2112:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2224:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2226:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2227:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2516:Mtus1 UTSW 8 41082739 missense probably damaging 1.00
R3414:Mtus1 UTSW 8 41048063 missense probably damaging 1.00
R3899:Mtus1 UTSW 8 41083129 missense probably benign
R4096:Mtus1 UTSW 8 41084247 missense probably damaging 0.99
R4831:Mtus1 UTSW 8 41083152 missense probably damaging 1.00
R4850:Mtus1 UTSW 8 41084470 missense possibly damaging 0.81
R4916:Mtus1 UTSW 8 41000801 missense probably damaging 1.00
R4940:Mtus1 UTSW 8 41041478 missense possibly damaging 0.52
R4988:Mtus1 UTSW 8 41084541 missense probably benign 0.05
R5133:Mtus1 UTSW 8 41083192 missense probably benign 0.00
R5468:Mtus1 UTSW 8 41084578 missense probably benign 0.00
R5598:Mtus1 UTSW 8 41022555 missense probably damaging 1.00
R5782:Mtus1 UTSW 8 41082727 missense probably damaging 1.00
R5860:Mtus1 UTSW 8 41076266 missense probably damaging 0.99
R5900:Mtus1 UTSW 8 41083497 missense possibly damaging 0.92
R5943:Mtus1 UTSW 8 41084265 missense probably benign 0.00
R6019:Mtus1 UTSW 8 41083040 missense probably benign 0.33
R6125:Mtus1 UTSW 8 41084539 missense probably damaging 0.99
R6197:Mtus1 UTSW 8 41084037 missense possibly damaging 0.90
R6488:Mtus1 UTSW 8 41041508 missense possibly damaging 0.52
R6869:Mtus1 UTSW 8 41082654 missense possibly damaging 0.71
R7117:Mtus1 UTSW 8 41083584 missense possibly damaging 0.95
R7126:Mtus1 UTSW 8 41015402 missense probably damaging 0.98
R7213:Mtus1 UTSW 8 41084487 missense probably damaging 0.99
R7308:Mtus1 UTSW 8 41082928 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCAGCAGGTTCAAGTCTGAAGCTC -3'
(R):5'- TGATGCAAACTGACAGTCCAGACG -3'

Sequencing Primer
(F):5'- CTGAAGCTCAGATTGGGGG -3'
(R):5'- ACAAGCTGTGACACTGGTTTC -3'
Posted On2013-04-24