Incidental Mutation 'R0358:Slc22a16'
ID29947
Institutional Source Beutler Lab
Gene Symbol Slc22a16
Ensembl Gene ENSMUSG00000019834
Gene Namesolute carrier family 22 (organic cation transporter), member 16
SynonymsOKB1, FLIPT2, OCT6, CT2, 4921504E14Rik
MMRRC Submission 038564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0358 (G1)
Quality Score210
Status Validated
Chromosome10
Chromosomal Location40570336-40604132 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 40587492 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019978] [ENSMUST00000078314]
Predicted Effect probably null
Transcript: ENSMUST00000019978
SMART Domains Protein: ENSMUSP00000019978
Gene: ENSMUSG00000019834

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Pfam:Sugar_tr 136 556 6.4e-25 PFAM
Pfam:MFS_1 177 514 3.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078314
SMART Domains Protein: ENSMUSP00000077428
Gene: ENSMUSG00000019834

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 114 535 5.1e-26 PFAM
Pfam:MFS_1 156 493 4.7e-20 PFAM
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G A 17: 79,628,156 probably benign Het
4932431P20Rik A T 7: 29,532,211 noncoding transcript Het
Abca16 A T 7: 120,544,716 K1651N probably benign Het
Abcb1b T C 5: 8,821,423 S326P probably benign Het
Ache A G 5: 137,290,373 T114A probably benign Het
Akap3 T A 6: 126,866,812 V798D probably damaging Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Aqp4 T C 18: 15,398,245 N153S probably benign Het
Arhgap23 G A 11: 97,463,588 V265M probably damaging Het
Arhgef25 A T 10: 127,184,453 M326K probably damaging Het
Atp6v1c2 T C 12: 17,284,960 probably benign Het
Cars A T 7: 143,588,482 probably benign Het
Cep83 A T 10: 94,719,731 M96L probably benign Het
Cfap46 A G 7: 139,651,533 probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cul7 G A 17: 46,663,744 probably null Het
Dhrs2 G A 14: 55,236,117 V78M probably damaging Het
Dhx38 A T 8: 109,552,462 D1051E probably benign Het
Eftud2 A G 11: 102,864,801 probably benign Het
Egln3 T C 12: 54,203,296 E89G possibly damaging Het
Eif2ak4 A G 2: 118,463,929 probably null Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fsip2 A T 2: 82,983,333 N3332I possibly damaging Het
Gbp2b A T 3: 142,606,789 E311V probably damaging Het
Gcnt2 G T 13: 40,860,853 A167S probably damaging Het
Gm9797 A T 10: 11,609,344 noncoding transcript Het
Gpatch3 A G 4: 133,577,904 probably null Het
Gpr22 T C 12: 31,709,982 N47S probably benign Het
Il18rap A T 1: 40,549,042 H600L possibly damaging Het
Larp7 A G 3: 127,547,088 probably null Het
Mep1a A G 17: 43,478,950 Y490H possibly damaging Het
Mrgprh T A 17: 12,877,350 V159D probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nrbp1 T A 5: 31,244,887 I64N probably damaging Het
Nup214 G A 2: 32,004,300 probably null Het
Olfr1394 T A 11: 49,160,244 C77S probably benign Het
Olfr149 A G 9: 39,702,001 I256T possibly damaging Het
Olfr532 G T 7: 140,418,943 L277M probably damaging Het
Olfr725 A T 14: 50,035,286 L39Q probably damaging Het
Pef1 A G 4: 130,127,387 T245A probably damaging Het
Phrf1 A G 7: 141,258,304 probably benign Het
Ppig A G 2: 69,743,598 probably benign Het
Ppp1r8 G T 4: 132,834,728 F60L probably damaging Het
Psmd11 G A 11: 80,462,684 probably benign Het
Ptk6 G T 2: 181,198,522 H230Q probably benign Het
Ptprd T C 4: 75,944,989 Y1496C probably damaging Het
Rhbdl3 G T 11: 80,353,631 W388L probably damaging Het
Rnf130 T A 11: 50,071,282 M185K probably benign Het
S100a13 A T 3: 90,515,992 I97F probably damaging Het
Tcte1 A T 17: 45,535,285 T272S probably benign Het
Terf1 T C 1: 15,805,838 V54A possibly damaging Het
Tmem63a T A 1: 180,956,423 N189K probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim66 G A 7: 109,460,176 Q954* probably null Het
Trpv4 A G 5: 114,630,432 F525S probably damaging Het
Ttll7 A G 3: 146,944,116 T634A probably benign Het
Ush2a T G 1: 188,537,780 N1741K possibly damaging Het
Zcchc6 T C 13: 59,782,104 D47G probably damaging Het
Zfp451 T A 1: 33,777,729 H163L probably damaging Het
Other mutations in Slc22a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc22a16 APN 10 40595282 missense probably damaging 1.00
IGL00334:Slc22a16 APN 10 40573934 missense probably benign 0.03
IGL00757:Slc22a16 APN 10 40581327 missense probably damaging 1.00
IGL01082:Slc22a16 APN 10 40573864 missense probably benign 0.40
IGL01337:Slc22a16 APN 10 40595314 missense possibly damaging 0.51
IGL01389:Slc22a16 APN 10 40585135 missense probably damaging 1.00
IGL01405:Slc22a16 APN 10 40585195 missense probably benign 0.36
IGL01667:Slc22a16 APN 10 40585018 missense probably damaging 1.00
IGL01700:Slc22a16 APN 10 40603908 missense unknown
IGL01792:Slc22a16 APN 10 40573932 missense possibly damaging 0.51
IGL02948:Slc22a16 APN 10 40573962 nonsense probably null
IGL03178:Slc22a16 APN 10 40573760 missense probably benign 0.09
PIT4418001:Slc22a16 UTSW 10 40603825 missense unknown
R0422:Slc22a16 UTSW 10 40591890 missense probably damaging 1.00
R0497:Slc22a16 UTSW 10 40584967 missense probably damaging 1.00
R1435:Slc22a16 UTSW 10 40587607 missense probably damaging 1.00
R1577:Slc22a16 UTSW 10 40603815 nonsense probably null
R1696:Slc22a16 UTSW 10 40584927 missense possibly damaging 0.75
R2022:Slc22a16 UTSW 10 40591877 missense probably damaging 1.00
R2065:Slc22a16 UTSW 10 40585020 missense possibly damaging 0.63
R2082:Slc22a16 UTSW 10 40585339 missense probably benign 0.02
R4083:Slc22a16 UTSW 10 40574069 missense probably damaging 1.00
R4588:Slc22a16 UTSW 10 40570681 intron probably benign
R4828:Slc22a16 UTSW 10 40573640 missense probably damaging 1.00
R4853:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R5127:Slc22a16 UTSW 10 40573957 missense probably benign 0.21
R5215:Slc22a16 UTSW 10 40581390 missense probably damaging 1.00
R5590:Slc22a16 UTSW 10 40581341 missense possibly damaging 0.94
R5626:Slc22a16 UTSW 10 40584853 critical splice acceptor site probably null
R5810:Slc22a16 UTSW 10 40595318 missense possibly damaging 0.86
R6675:Slc22a16 UTSW 10 40573840 nonsense probably null
R6692:Slc22a16 UTSW 10 40603905 missense unknown
R6738:Slc22a16 UTSW 10 40585302 missense probably damaging 0.99
R7158:Slc22a16 UTSW 10 40573741 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CAAGCCAGTGAGTTAAAACACGGTG -3'
(R):5'- ACTAAAGTCTTTCCACGAACCTGCC -3'

Sequencing Primer
(F):5'- caaacaaacaaacaaacaaaaaaacC -3'
(R):5'- CACGAACCTGCCACAGC -3'
Posted On2013-04-24