Incidental Mutation 'R0359:Myom3'
ID29979
Institutional Source Beutler Lab
Gene Symbol Myom3
Ensembl Gene ENSMUSG00000037139
Gene Namemyomesin family, member 3
Synonyms8430427K15Rik
MMRRC Submission 038565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R0359 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135759715-135815564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135778143 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 448 (V448M)
Ref Sequence ENSEMBL: ENSMUSP00000101480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105854]
Predicted Effect probably damaging
Transcript: ENSMUST00000105854
AA Change: V448M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101480
Gene: ENSMUSG00000037139
AA Change: V448M

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 53 83 N/A INTRINSIC
coiled coil region 119 150 N/A INTRINSIC
IG 160 248 7.64e-9 SMART
IG 277 364 1.37e-1 SMART
FN3 374 457 4.8e-13 SMART
FN3 502 585 9.99e-11 SMART
FN3 603 684 1.74e-10 SMART
FN3 702 785 2.5e-11 SMART
FN3 804 887 7.73e-17 SMART
Blast:IG_like 904 1098 1e-100 BLAST
PDB:2JTD|A 1000 1105 4e-25 PDB
low complexity region 1107 1119 N/A INTRINSIC
IG 1127 1209 4.46e-1 SMART
IGc2 1349 1416 1.4e-7 SMART
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
2310003L06Rik A T 5: 87,964,596 probably benign Het
Abcb5 A G 12: 118,940,332 S213P probably damaging Het
Agpat1 A G 17: 34,610,577 I42V probably benign Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
BB014433 G T 8: 15,042,540 C104* probably null Het
Bsn C T 9: 108,111,846 G2236S possibly damaging Het
Casp9 A G 4: 141,793,910 E19G probably damaging Het
Ces1g T C 8: 93,328,535 probably benign Het
Cfap65 T A 1: 74,920,601 M797L probably benign Het
Col14a1 A G 15: 55,407,868 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col27a1 G T 4: 63,314,727 probably null Het
Col6a4 T A 9: 105,997,146 H2214L probably benign Het
Ctu2 T G 8: 122,478,193 S72R probably damaging Het
Cyp24a1 T A 2: 170,491,699 M245L possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Diaph3 T C 14: 86,969,502 R501G probably benign Het
Dip2b A G 15: 100,211,993 D1453G probably damaging Het
Dnah2 G A 11: 69,529,531 T119M probably benign Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Farp1 A T 14: 121,255,396 probably benign Het
Foxf1 T C 8: 121,085,003 V202A possibly damaging Het
Fras1 G A 5: 96,762,590 V3293I probably damaging Het
Fuk T C 8: 110,893,259 probably null Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Gclm T C 3: 122,255,620 probably benign Het
Gemin4 G A 11: 76,212,162 T591M probably benign Het
Glrx3 T C 7: 137,453,485 S119P possibly damaging Het
Gm16485 G T 9: 8,972,436 probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Kpna2 A G 11: 106,991,322 L226S probably damaging Het
Nalcn A G 14: 123,299,168 S1224P probably damaging Het
Olfr1354 A G 10: 78,917,343 T168A probably benign Het
Olfr504 C T 7: 108,565,514 D94N probably benign Het
Olfr666 A T 7: 104,893,314 F105I probably damaging Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pot1a G A 6: 25,771,680 probably benign Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ppp1r1a T A 15: 103,533,488 D51V probably damaging Het
Ptprz1 T A 6: 22,973,176 probably benign Het
Rad51ap1 A T 6: 126,934,741 V61D probably damaging Het
Reln G A 5: 22,048,800 L605F probably damaging Het
Riok3 T C 18: 12,148,949 I325T probably damaging Het
Sclt1 A T 3: 41,661,570 probably null Het
Slc25a39 A G 11: 102,406,569 V24A possibly damaging Het
Slc9a3 T G 13: 74,157,607 S248A probably damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Spen T C 4: 141,516,870 S285G unknown Het
Stxbp5l A G 16: 37,216,078 probably benign Het
Thsd7a G A 6: 12,352,031 P1055L probably damaging Het
Tmed3 C T 9: 89,699,789 S207N possibly damaging Het
Trerf1 G T 17: 47,341,136 noncoding transcript Het
Triml1 A T 8: 43,130,505 V353E probably damaging Het
Ttn G A 2: 76,719,057 R31759C probably damaging Het
Ugt2b37 T C 5: 87,250,584 Q331R probably benign Het
Urb1 A G 16: 90,791,160 I420T probably damaging Het
Vmn1r68 A T 7: 10,527,274 L299Q probably damaging Het
Vmn1r81 T A 7: 12,259,950 T244S probably damaging Het
Vps13a A G 19: 16,641,577 F2875S probably damaging Het
Wscd1 A G 11: 71,766,866 M166V probably damaging Het
Zfp296 T C 7: 19,579,939 Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Other mutations in Myom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Myom3 APN 4 135762571 missense possibly damaging 0.66
IGL01490:Myom3 APN 4 135810778 missense possibly damaging 0.79
IGL01931:Myom3 APN 4 135789639 missense probably benign 0.05
IGL01935:Myom3 APN 4 135788381 missense probably damaging 1.00
IGL01939:Myom3 APN 4 135765589 missense possibly damaging 0.95
IGL01981:Myom3 APN 4 135785849 nonsense probably null
IGL01985:Myom3 APN 4 135765702 critical splice donor site probably null
IGL02043:Myom3 APN 4 135770675 missense probably damaging 1.00
IGL02477:Myom3 APN 4 135779368 missense probably benign 0.22
IGL02733:Myom3 APN 4 135814303 nonsense probably null
IGL03253:Myom3 APN 4 135783097 missense possibly damaging 0.85
R0525:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0665:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0668:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0690:Myom3 UTSW 4 135788426 splice site probably benign
R1235:Myom3 UTSW 4 135789543 missense probably benign 0.09
R1692:Myom3 UTSW 4 135775551 missense probably benign 0.00
R1793:Myom3 UTSW 4 135810755 missense probably benign 0.42
R1859:Myom3 UTSW 4 135779396 missense probably benign 0.01
R1863:Myom3 UTSW 4 135778037 missense probably benign
R1876:Myom3 UTSW 4 135779400 missense probably benign 0.01
R2103:Myom3 UTSW 4 135776412 missense probably benign 0.05
R2152:Myom3 UTSW 4 135803233 missense probably benign 0.05
R4633:Myom3 UTSW 4 135775699 missense probably benign 0.00
R4726:Myom3 UTSW 4 135807275 splice site probably null
R4884:Myom3 UTSW 4 135783055 missense possibly damaging 0.90
R4943:Myom3 UTSW 4 135814274 missense possibly damaging 0.73
R5040:Myom3 UTSW 4 135789659 missense probably damaging 1.00
R5151:Myom3 UTSW 4 135789572 missense probably benign 0.01
R5158:Myom3 UTSW 4 135765586 missense probably damaging 0.99
R5169:Myom3 UTSW 4 135775578 missense probably benign 0.01
R5239:Myom3 UTSW 4 135800992 splice site probably benign
R6130:Myom3 UTSW 4 135762571 missense probably benign
R6253:Myom3 UTSW 4 135785892 missense probably benign 0.07
R6253:Myom3 UTSW 4 135801003 missense probably benign 0.00
R6331:Myom3 UTSW 4 135776377 missense possibly damaging 0.46
R6346:Myom3 UTSW 4 135806051 missense probably benign 0.00
R6502:Myom3 UTSW 4 135762513 start gained probably benign
R6613:Myom3 UTSW 4 135812459 missense possibly damaging 0.80
R6899:Myom3 UTSW 4 135803292 missense probably damaging 1.00
R6969:Myom3 UTSW 4 135801060 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGGAGCAAGGCTTCTAAGTGAG -3'
(R):5'- TCTGCCTGAGACTAGGGCTTTCTG -3'

Sequencing Primer
(F):5'- CTTCTAAGTGAGAGCAGAAGACTCC -3'
(R):5'- gggagtcaaacgaaatggaaag -3'
Posted On2013-04-24