Incidental Mutation 'R0359:Dip2b'
ID30021
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
MMRRC Submission 038565-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R0359 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100211993 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1453 (D1453G)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023768
AA Change: D1219G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: D1219G

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: D1453G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: D1453G

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108971
AA Change: D1219G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: D1219G

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Meta Mutation Damage Score 0.436 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
2310003L06Rik A T 5: 87,964,596 probably benign Het
Abcb5 A G 12: 118,940,332 S213P probably damaging Het
Agpat1 A G 17: 34,610,577 I42V probably benign Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
BB014433 G T 8: 15,042,540 C104* probably null Het
Bsn C T 9: 108,111,846 G2236S possibly damaging Het
Casp9 A G 4: 141,793,910 E19G probably damaging Het
Ces1g T C 8: 93,328,535 probably benign Het
Cfap65 T A 1: 74,920,601 M797L probably benign Het
Col14a1 A G 15: 55,407,868 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col27a1 G T 4: 63,314,727 probably null Het
Col6a4 T A 9: 105,997,146 H2214L probably benign Het
Ctu2 T G 8: 122,478,193 S72R probably damaging Het
Cyp24a1 T A 2: 170,491,699 M245L possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Diaph3 T C 14: 86,969,502 R501G probably benign Het
Dnah2 G A 11: 69,529,531 T119M probably benign Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Farp1 A T 14: 121,255,396 probably benign Het
Foxf1 T C 8: 121,085,003 V202A possibly damaging Het
Fras1 G A 5: 96,762,590 V3293I probably damaging Het
Fuk T C 8: 110,893,259 probably null Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Gclm T C 3: 122,255,620 probably benign Het
Gemin4 G A 11: 76,212,162 T591M probably benign Het
Glrx3 T C 7: 137,453,485 S119P possibly damaging Het
Gm16485 G T 9: 8,972,436 probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Kpna2 A G 11: 106,991,322 L226S probably damaging Het
Myom3 G A 4: 135,778,143 V448M probably damaging Het
Nalcn A G 14: 123,299,168 S1224P probably damaging Het
Olfr1354 A G 10: 78,917,343 T168A probably benign Het
Olfr504 C T 7: 108,565,514 D94N probably benign Het
Olfr666 A T 7: 104,893,314 F105I probably damaging Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pot1a G A 6: 25,771,680 probably benign Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ppp1r1a T A 15: 103,533,488 D51V probably damaging Het
Ptprz1 T A 6: 22,973,176 probably benign Het
Rad51ap1 A T 6: 126,934,741 V61D probably damaging Het
Reln G A 5: 22,048,800 L605F probably damaging Het
Riok3 T C 18: 12,148,949 I325T probably damaging Het
Sclt1 A T 3: 41,661,570 probably null Het
Slc25a39 A G 11: 102,406,569 V24A possibly damaging Het
Slc9a3 T G 13: 74,157,607 S248A probably damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Spen T C 4: 141,516,870 S285G unknown Het
Stxbp5l A G 16: 37,216,078 probably benign Het
Thsd7a G A 6: 12,352,031 P1055L probably damaging Het
Tmed3 C T 9: 89,699,789 S207N possibly damaging Het
Trerf1 G T 17: 47,341,136 noncoding transcript Het
Triml1 A T 8: 43,130,505 V353E probably damaging Het
Ttn G A 2: 76,719,057 R31759C probably damaging Het
Ugt2b37 T C 5: 87,250,584 Q331R probably benign Het
Urb1 A G 16: 90,791,160 I420T probably damaging Het
Vmn1r68 A T 7: 10,527,274 L299Q probably damaging Het
Vmn1r81 T A 7: 12,259,950 T244S probably damaging Het
Vps13a A G 19: 16,641,577 F2875S probably damaging Het
Wscd1 A G 11: 71,766,866 M166V probably damaging Het
Zfp296 T C 7: 19,579,939 Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 unclassified probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 unclassified probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 unclassified probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGACTCAGTGATGTGTCCCTC -3'
(R):5'- TGACTCAGCAACACAGTGGCTC -3'

Sequencing Primer
(F):5'- GTGATGTGTCCCTCATAGCAAAC -3'
(R):5'- TTGAGACAGGCTTTGAGACCAC -3'
Posted On2013-04-24