Incidental Mutation 'R0361:Mta1'
ID30131
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Namemetastasis associated 1
Synonyms
MMRRC Submission 038567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0361 (G1)
Quality Score218
Status Not validated
Chromosome12
Chromosomal Location113098278-113137206 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 113133341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]
Predicted Effect probably null
Transcript: ENSMUST00000009099
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000069690
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109723
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109726
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109727
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156030
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,413,634 T303P possibly damaging Het
1700010I14Rik G T 17: 8,992,546 V176L probably benign Het
1700034J05Rik T C 6: 146,952,371 T262A possibly damaging Het
Adgrl3 A T 5: 81,760,697 I1165F probably damaging Het
Ankhd1 T C 18: 36,647,214 I1773T probably damaging Het
Api5 A T 2: 94,423,497 L287* probably null Het
Apol10b A T 15: 77,585,386 M197K possibly damaging Het
Bcl2 G A 1: 106,712,694 R63W probably damaging Het
Cacna1h A G 17: 25,389,422 M731T probably damaging Het
Cav1 C A 6: 17,339,353 R146S possibly damaging Het
Cdhr2 A T 13: 54,734,007 I1118F probably damaging Het
Cdk7 A T 13: 100,711,554 Y153* probably null Het
Cemip A G 7: 83,964,010 I660T probably benign Het
Cfap65 A T 1: 74,925,440 L518Q probably damaging Het
Cngb3 A G 4: 19,366,467 H176R probably benign Het
Cux1 T A 5: 136,279,497 I1263F probably damaging Het
Dnajc13 A G 9: 104,167,059 M1867T probably benign Het
Dock2 A G 11: 34,438,327 L202P probably damaging Het
Dyrk3 A G 1: 131,130,032 S100P probably benign Het
Efr3b A T 12: 3,977,923 S376T probably benign Het
Eps8l2 A C 7: 141,356,199 N222T probably benign Het
Ermp1 A T 19: 29,631,406 Y158N probably damaging Het
Fam13a A G 6: 58,987,174 V91A probably benign Het
Fat3 A G 9: 15,998,403 V2101A possibly damaging Het
Fsip2 T C 2: 82,975,505 S723P possibly damaging Het
Garem1 G T 18: 21,299,744 C9* probably null Het
Gdpd5 A G 7: 99,458,790 I530V possibly damaging Het
Gm15217 T A 14: 46,380,384 probably benign Het
Gm4922 T C 10: 18,783,541 T478A probably benign Het
Gm5483 T C 16: 36,184,278 S7P probably damaging Het
H2-M5 A G 17: 36,987,436 I329T possibly damaging Het
Ing4 G A 6: 125,047,894 C200Y probably damaging Het
Kcnip1 A T 11: 33,843,177 M5K probably benign Het
Kdsr T C 1: 106,747,787 E102G probably damaging Het
Krt15 C T 11: 100,133,181 V346M probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc55 A T 2: 85,196,245 M145K probably damaging Het
Lrrtm2 A G 18: 35,212,932 I439T probably benign Het
Map2k6 T C 11: 110,499,509 F290L probably damaging Het
Mb21d1 T A 9: 78,433,252 K399N probably damaging Het
Me1 T A 9: 86,651,002 I136F probably damaging Het
Mfap2 A G 4: 141,014,983 D98G probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mst1 T C 9: 108,084,897 F696L probably damaging Het
Myh15 A T 16: 49,114,005 N645I probably benign Het
Myo7b T A 18: 32,014,209 I94F probably damaging Het
Nefh A T 11: 4,940,799 S607T probably benign Het
Noa1 G A 5: 77,297,173 Q600* probably null Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Oas2 A T 5: 120,738,401 F492L probably damaging Het
Olfm3 T A 3: 115,120,973 D211E probably damaging Het
Olfr1390 A T 11: 49,340,814 Y94F probably benign Het
Osmr A G 15: 6,841,951 probably null Het
Plagl2 A T 2: 153,231,603 D459E probably benign Het
Plch2 T C 4: 155,006,711 D148G possibly damaging Het
Plxnc1 C A 10: 94,865,007 C605F probably damaging Het
Ppm1m T C 9: 106,198,126 E108G probably damaging Het
Prr14l A C 5: 32,793,641 L1936R probably damaging Het
Ralgapa1 A G 12: 55,676,569 I1771T possibly damaging Het
Rhobtb2 T C 14: 69,795,908 T538A probably benign Het
Rictor A G 15: 6,784,107 N1025D possibly damaging Het
Sec23a T G 12: 58,991,018 D324A probably damaging Het
Srgap1 A T 10: 122,047,192 M1K probably null Het
Syne2 T A 12: 75,918,610 F801I probably benign Het
Synrg T A 11: 84,024,337 probably null Het
Tas2r137 T G 6: 40,491,298 F21V probably benign Het
Tmem260 A T 14: 48,452,047 T108S possibly damaging Het
Trim2 T C 3: 84,190,776 Y406C probably damaging Het
Ttn T C 2: 76,843,402 probably benign Het
Vmn1r53 A T 6: 90,224,082 S87T possibly damaging Het
Vmn2r115 T A 17: 23,345,222 Y123N probably benign Het
Vmn2r28 T A 7: 5,493,716 I46F probably benign Het
Zan T C 5: 137,396,766 T4381A unknown Het
Zfp457 A G 13: 67,292,646 F622L probably damaging Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Zfy1 T C Y: 726,121 H548R possibly damaging Het
Zmym4 A T 4: 126,911,145 S441T probably benign Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 intron probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTACTGCGTTTCTGAACCACACCC -3'
(R):5'- ATGCGAGCAGTCACAGCGCAATAG -3'

Sequencing Primer
(F):5'- CTTACCCTTTCATTTCCACAGAGAC -3'
(R):5'- TCGTGCAAGGACAGTCCATC -3'
Posted On2013-04-24