Incidental Mutation 'R0363:Abhd5'
ID30191
Institutional Source Beutler Lab
Gene Symbol Abhd5
Ensembl Gene ENSMUSG00000032540
Gene Nameabhydrolase domain containing 5
SynonymsNCIE2, IECN5, 2010002J10Rik, CGI-58, 1300003D03Rik
MMRRC Submission 038569-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R0363 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122351608-122381524 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122368146 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 133 (F133L)
Ref Sequence ENSEMBL: ENSMUSP00000122274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035128] [ENSMUST00000111497] [ENSMUST00000154161] [ENSMUST00000156520] [ENSMUST00000175973]
Predicted Effect probably benign
Transcript: ENSMUST00000035128
Predicted Effect probably benign
Transcript: ENSMUST00000111497
SMART Domains Protein: ENSMUSP00000107123
Gene: ENSMUSG00000032540

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 3 189 7.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154161
AA Change: F90L

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122939
Gene: ENSMUSG00000032540
AA Change: F90L

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 36 127 1.4e-8 PFAM
Pfam:Abhydrolase_6 37 127 1.5e-18 PFAM
Pfam:Abhydrolase_1 61 127 2.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156520
AA Change: F133L

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122274
Gene: ENSMUSG00000032540
AA Change: F133L

DomainStartEndE-ValueType
Pfam:Hydrolase_4 75 246 4.1e-11 PFAM
Pfam:Abhydrolase_1 78 208 6e-20 PFAM
Pfam:Abhydrolase_5 79 330 6.7e-11 PFAM
Pfam:Abhydrolase_6 80 342 8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216775
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.5%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a large family of proteins defined by an alpha/beta hydrolase fold, and contains three sequence motifs that correspond to a catalytic triad found in the esterase/lipase/thioesterase subfamily. It differs from other members of this subfamily in that its putative catalytic triad contains an asparagine instead of the serine residue. Mutations in this gene have been associated with Chanarin-Dorfman syndrome, a triglyceride storage disease with impaired long-chain fatty acid oxidation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, impaired triacylglycerol catabolism, hepatic steatosis, and lethal skin barrier defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik T A 4: 109,524,323 Q86L probably null Het
5430403G16Rik T C 5: 109,676,888 E232G probably benign Het
Abhd2 A G 7: 79,350,813 D262G possibly damaging Het
Agap2 T A 10: 127,090,965 V957E probably damaging Het
Ankrd12 T C 17: 65,985,681 K919R probably damaging Het
Ap1m1 T C 8: 72,256,724 probably benign Het
Ap1m1 T C 8: 72,252,894 S245P probably benign Het
Apcdd1 A G 18: 62,937,097 Y145C possibly damaging Het
Apob A T 12: 8,010,136 N2840Y probably damaging Het
Arel1 A G 12: 84,934,253 S327P probably damaging Het
Arhgap21 C A 2: 20,881,133 R421L probably damaging Het
Ccdc85a A T 11: 28,583,400 I48N probably damaging Het
Chd6 A G 2: 161,014,324 S672P probably damaging Het
Ciz1 G C 2: 32,377,363 probably null Het
Cmbl G A 15: 31,585,442 probably null Het
Cmya5 A G 13: 93,094,869 V1237A possibly damaging Het
Cntnap4 A T 8: 112,856,511 K1074* probably null Het
Cntnap5b A G 1: 100,274,468 M347V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cuzd1 A T 7: 131,316,262 M203K probably benign Het
Cyp3a16 T C 5: 145,455,879 probably benign Het
Dlgap3 A G 4: 127,235,521 E892G probably damaging Het
Dnah7b T C 1: 46,236,788 S2612P probably damaging Het
Epas1 T G 17: 86,805,848 probably benign Het
Etv5 G A 16: 22,411,708 A192V probably benign Het
Fa2h T A 8: 111,349,289 H234L probably damaging Het
Fcho1 T C 8: 71,717,490 Y47C probably damaging Het
Flvcr1 T A 1: 191,012,254 probably benign Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b T C 8: 81,884,257 probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kmt2a A G 9: 44,809,713 probably null Het
Krt4 G A 15: 101,924,646 R9C possibly damaging Het
Map1a T C 2: 121,302,044 S876P probably damaging Het
Mettl21e A G 1: 44,211,030 probably null Het
Msh2 C T 17: 87,717,476 T594M probably benign Het
Mtmr3 A G 11: 4,487,536 S973P probably damaging Het
Muc5ac A T 7: 141,800,960 M889L probably benign Het
Ntn1 A G 11: 68,385,543 I193T probably benign Het
Nudt13 A T 14: 20,309,783 I193F probably damaging Het
Olfr1272 A T 2: 90,281,856 S240T probably damaging Het
Olfr134 A G 17: 38,175,447 D121G probably damaging Het
Olfr410 C T 11: 74,335,099 G44D probably damaging Het
Olfr498 A T 7: 108,465,734 T137S possibly damaging Het
Otulin A G 15: 27,606,295 V344A probably damaging Het
P2rx7 C T 5: 122,657,030 Q128* probably null Het
Pcdhb22 G A 18: 37,519,160 R227H probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pltp C T 2: 164,840,136 R394H probably benign Het
Ppip5k1 C G 2: 121,347,355 A324P probably damaging Het
Pramef17 C T 4: 143,991,651 M407I probably benign Het
Prdm13 A C 4: 21,679,737 V251G unknown Het
Prkg1 T C 19: 31,664,196 E29G probably damaging Het
Prrc2c A G 1: 162,697,811 S409P unknown Het
Rp1 T A 1: 4,347,718 D1057V probably damaging Het
Rttn G A 18: 89,010,955 C599Y probably damaging Het
Shisa6 C T 11: 66,525,327 R213Q probably benign Het
Slc3a1 T C 17: 85,032,845 Y232H probably damaging Het
Slx4 G A 16: 3,980,089 A1477V probably damaging Het
Ssrp1 T G 2: 85,040,674 I218S probably damaging Het
St6galnac1 A C 11: 116,768,930 S186A probably benign Het
Stab1 A G 14: 31,159,008 probably benign Het
Sycp2 T C 2: 178,346,411 probably benign Het
Syne2 T A 12: 76,072,207 I5867N probably damaging Het
Taar7f T A 10: 24,049,941 D144E probably damaging Het
Tmem136 A T 9: 43,111,753 M84K probably damaging Het
Tmem87b T A 2: 128,831,233 S196T probably damaging Het
Tnfrsf21 A G 17: 43,037,877 T127A probably benign Het
Trp73 A G 4: 154,063,949 I336T probably benign Het
Ttl A G 2: 129,076,061 I148V probably damaging Het
Ttll7 T C 3: 146,944,215 Y667H probably benign Het
Ubr4 A G 4: 139,391,860 T152A probably damaging Het
Vmn1r58 A T 7: 5,410,637 V198E probably damaging Het
Vps52 T A 17: 33,962,117 F376L probably benign Het
Other mutations in Abhd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Abhd5 APN 9 122368081 missense possibly damaging 0.73
IGL02143:Abhd5 APN 9 122365213 start codon destroyed probably null 0.01
IGL02949:Abhd5 APN 9 122377915 missense possibly damaging 0.51
IGL03248:Abhd5 APN 9 122368225 missense probably damaging 1.00
R1519:Abhd5 UTSW 9 122379014 splice site probably null
R2108:Abhd5 UTSW 9 122377940 missense probably damaging 1.00
R4818:Abhd5 UTSW 9 122363800 splice site probably null
R5048:Abhd5 UTSW 9 122377903 missense probably damaging 1.00
R5786:Abhd5 UTSW 9 122363803 splice site probably null
R6141:Abhd5 UTSW 9 122377933 missense probably benign 0.01
R6901:Abhd5 UTSW 9 122368155 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGTGTCCCCTGCACTTACAAGAAAG -3'
(R):5'- TGAGGCTCATCGGTAACCACCAAG -3'

Sequencing Primer
(F):5'- CAGAATATGGACGCTGATGTTCTC -3'
(R):5'- TCGGTAACCACCAAGAACGG -3'
Posted On2013-04-24