Incidental Mutation 'R0363:Tnfrsf21'
ID30210
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 038569-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0363 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43037877 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 127 (T127A)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: T127A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: T127A

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.5%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik T A 4: 109,524,323 Q86L probably null Het
5430403G16Rik T C 5: 109,676,888 E232G probably benign Het
Abhd2 A G 7: 79,350,813 D262G possibly damaging Het
Abhd5 T C 9: 122,368,146 F133L possibly damaging Het
Agap2 T A 10: 127,090,965 V957E probably damaging Het
Ankrd12 T C 17: 65,985,681 K919R probably damaging Het
Ap1m1 T C 8: 72,256,724 probably benign Het
Ap1m1 T C 8: 72,252,894 S245P probably benign Het
Apcdd1 A G 18: 62,937,097 Y145C possibly damaging Het
Apob A T 12: 8,010,136 N2840Y probably damaging Het
Arel1 A G 12: 84,934,253 S327P probably damaging Het
Arhgap21 C A 2: 20,881,133 R421L probably damaging Het
Ccdc85a A T 11: 28,583,400 I48N probably damaging Het
Chd6 A G 2: 161,014,324 S672P probably damaging Het
Ciz1 G C 2: 32,377,363 probably null Het
Cmbl G A 15: 31,585,442 probably null Het
Cmya5 A G 13: 93,094,869 V1237A possibly damaging Het
Cntnap4 A T 8: 112,856,511 K1074* probably null Het
Cntnap5b A G 1: 100,274,468 M347V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cuzd1 A T 7: 131,316,262 M203K probably benign Het
Cyp3a16 T C 5: 145,455,879 probably benign Het
Dlgap3 A G 4: 127,235,521 E892G probably damaging Het
Dnah7b T C 1: 46,236,788 S2612P probably damaging Het
Epas1 T G 17: 86,805,848 probably benign Het
Etv5 G A 16: 22,411,708 A192V probably benign Het
Fa2h T A 8: 111,349,289 H234L probably damaging Het
Fcho1 T C 8: 71,717,490 Y47C probably damaging Het
Flvcr1 T A 1: 191,012,254 probably benign Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b T C 8: 81,884,257 probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kmt2a A G 9: 44,809,713 probably null Het
Krt4 G A 15: 101,924,646 R9C possibly damaging Het
Map1a T C 2: 121,302,044 S876P probably damaging Het
Mettl21e A G 1: 44,211,030 probably null Het
Msh2 C T 17: 87,717,476 T594M probably benign Het
Mtmr3 A G 11: 4,487,536 S973P probably damaging Het
Muc5ac A T 7: 141,800,960 M889L probably benign Het
Ntn1 A G 11: 68,385,543 I193T probably benign Het
Nudt13 A T 14: 20,309,783 I193F probably damaging Het
Olfr1272 A T 2: 90,281,856 S240T probably damaging Het
Olfr134 A G 17: 38,175,447 D121G probably damaging Het
Olfr410 C T 11: 74,335,099 G44D probably damaging Het
Olfr498 A T 7: 108,465,734 T137S possibly damaging Het
Otulin A G 15: 27,606,295 V344A probably damaging Het
P2rx7 C T 5: 122,657,030 Q128* probably null Het
Pcdhb22 G A 18: 37,519,160 R227H probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pltp C T 2: 164,840,136 R394H probably benign Het
Ppip5k1 C G 2: 121,347,355 A324P probably damaging Het
Pramef17 C T 4: 143,991,651 M407I probably benign Het
Prdm13 A C 4: 21,679,737 V251G unknown Het
Prkg1 T C 19: 31,664,196 E29G probably damaging Het
Prrc2c A G 1: 162,697,811 S409P unknown Het
Rp1 T A 1: 4,347,718 D1057V probably damaging Het
Rttn G A 18: 89,010,955 C599Y probably damaging Het
Shisa6 C T 11: 66,525,327 R213Q probably benign Het
Slc3a1 T C 17: 85,032,845 Y232H probably damaging Het
Slx4 G A 16: 3,980,089 A1477V probably damaging Het
Ssrp1 T G 2: 85,040,674 I218S probably damaging Het
St6galnac1 A C 11: 116,768,930 S186A probably benign Het
Stab1 A G 14: 31,159,008 probably benign Het
Sycp2 T C 2: 178,346,411 probably benign Het
Syne2 T A 12: 76,072,207 I5867N probably damaging Het
Taar7f T A 10: 24,049,941 D144E probably damaging Het
Tmem136 A T 9: 43,111,753 M84K probably damaging Het
Tmem87b T A 2: 128,831,233 S196T probably damaging Het
Trp73 A G 4: 154,063,949 I336T probably benign Het
Ttl A G 2: 129,076,061 I148V probably damaging Het
Ttll7 T C 3: 146,944,215 Y667H probably benign Het
Ubr4 A G 4: 139,391,860 T152A probably damaging Het
Vmn1r58 A T 7: 5,410,637 V198E probably damaging Het
Vps52 T A 17: 33,962,117 F376L probably benign Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
palmer_park UTSW 17 43038010 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTGGATTCCTCAGCACCATCAC -3'
(R):5'- ATCACACTGGAAGGCACGTCAGAG -3'

Sequencing Primer
(F):5'- TGCTAACCTGCGACAAGTG -3'
(R):5'- ACTGCTTACAGCGCACAT -3'
Posted On2013-04-24