Incidental Mutation 'R0363:Pcdhb22'
ID30215
Institutional Source Beutler Lab
Gene Symbol Pcdhb22
Ensembl Gene ENSMUSG00000073591
Gene Nameprotocadherin beta 22
SynonymsPcdhbV, Pcdhb15
MMRRC Submission 038569-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0363 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37517871-37524479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37519160 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 227 (R227H)
Ref Sequence ENSEMBL: ENSMUSP00000141521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000061405
SMART Domains Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Cadherin_2 30 110 4.2e-30 PFAM
CA 153 238 1.8e-17 SMART
CA 262 343 1.54e-25 SMART
CA 367 448 1.03e-21 SMART
CA 472 558 3.41e-27 SMART
CA 588 669 1.54e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097609
SMART Domains Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 28 110 5.8e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
Pfam:Cadherin_C_2 685 768 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192409
AA Change: R227H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591
AA Change: R227H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 27 110 2.5e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
transmembrane domain 689 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.5%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik T A 4: 109,524,323 Q86L probably null Het
5430403G16Rik T C 5: 109,676,888 E232G probably benign Het
Abhd2 A G 7: 79,350,813 D262G possibly damaging Het
Abhd5 T C 9: 122,368,146 F133L possibly damaging Het
Agap2 T A 10: 127,090,965 V957E probably damaging Het
Ankrd12 T C 17: 65,985,681 K919R probably damaging Het
Ap1m1 T C 8: 72,256,724 probably benign Het
Ap1m1 T C 8: 72,252,894 S245P probably benign Het
Apcdd1 A G 18: 62,937,097 Y145C possibly damaging Het
Apob A T 12: 8,010,136 N2840Y probably damaging Het
Arel1 A G 12: 84,934,253 S327P probably damaging Het
Arhgap21 C A 2: 20,881,133 R421L probably damaging Het
Ccdc85a A T 11: 28,583,400 I48N probably damaging Het
Chd6 A G 2: 161,014,324 S672P probably damaging Het
Ciz1 G C 2: 32,377,363 probably null Het
Cmbl G A 15: 31,585,442 probably null Het
Cmya5 A G 13: 93,094,869 V1237A possibly damaging Het
Cntnap4 A T 8: 112,856,511 K1074* probably null Het
Cntnap5b A G 1: 100,274,468 M347V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cuzd1 A T 7: 131,316,262 M203K probably benign Het
Cyp3a16 T C 5: 145,455,879 probably benign Het
Dlgap3 A G 4: 127,235,521 E892G probably damaging Het
Dnah7b T C 1: 46,236,788 S2612P probably damaging Het
Epas1 T G 17: 86,805,848 probably benign Het
Etv5 G A 16: 22,411,708 A192V probably benign Het
Fa2h T A 8: 111,349,289 H234L probably damaging Het
Fcho1 T C 8: 71,717,490 Y47C probably damaging Het
Flvcr1 T A 1: 191,012,254 probably benign Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b T C 8: 81,884,257 probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kmt2a A G 9: 44,809,713 probably null Het
Krt4 G A 15: 101,924,646 R9C possibly damaging Het
Map1a T C 2: 121,302,044 S876P probably damaging Het
Mettl21e A G 1: 44,211,030 probably null Het
Msh2 C T 17: 87,717,476 T594M probably benign Het
Mtmr3 A G 11: 4,487,536 S973P probably damaging Het
Muc5ac A T 7: 141,800,960 M889L probably benign Het
Ntn1 A G 11: 68,385,543 I193T probably benign Het
Nudt13 A T 14: 20,309,783 I193F probably damaging Het
Olfr1272 A T 2: 90,281,856 S240T probably damaging Het
Olfr134 A G 17: 38,175,447 D121G probably damaging Het
Olfr410 C T 11: 74,335,099 G44D probably damaging Het
Olfr498 A T 7: 108,465,734 T137S possibly damaging Het
Otulin A G 15: 27,606,295 V344A probably damaging Het
P2rx7 C T 5: 122,657,030 Q128* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pltp C T 2: 164,840,136 R394H probably benign Het
Ppip5k1 C G 2: 121,347,355 A324P probably damaging Het
Pramef17 C T 4: 143,991,651 M407I probably benign Het
Prdm13 A C 4: 21,679,737 V251G unknown Het
Prkg1 T C 19: 31,664,196 E29G probably damaging Het
Prrc2c A G 1: 162,697,811 S409P unknown Het
Rp1 T A 1: 4,347,718 D1057V probably damaging Het
Rttn G A 18: 89,010,955 C599Y probably damaging Het
Shisa6 C T 11: 66,525,327 R213Q probably benign Het
Slc3a1 T C 17: 85,032,845 Y232H probably damaging Het
Slx4 G A 16: 3,980,089 A1477V probably damaging Het
Ssrp1 T G 2: 85,040,674 I218S probably damaging Het
St6galnac1 A C 11: 116,768,930 S186A probably benign Het
Stab1 A G 14: 31,159,008 probably benign Het
Sycp2 T C 2: 178,346,411 probably benign Het
Syne2 T A 12: 76,072,207 I5867N probably damaging Het
Taar7f T A 10: 24,049,941 D144E probably damaging Het
Tmem136 A T 9: 43,111,753 M84K probably damaging Het
Tmem87b T A 2: 128,831,233 S196T probably damaging Het
Tnfrsf21 A G 17: 43,037,877 T127A probably benign Het
Trp73 A G 4: 154,063,949 I336T probably benign Het
Ttl A G 2: 129,076,061 I148V probably damaging Het
Ttll7 T C 3: 146,944,215 Y667H probably benign Het
Ubr4 A G 4: 139,391,860 T152A probably damaging Het
Vmn1r58 A T 7: 5,410,637 V198E probably damaging Het
Vps52 T A 17: 33,962,117 F376L probably benign Het
Other mutations in Pcdhb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pcdhb22 APN 18 37520132 missense probably damaging 1.00
IGL00775:Pcdhb22 APN 18 37519742 missense probably benign 0.09
IGL01414:Pcdhb22 APN 18 37519496 missense probably damaging 1.00
IGL01819:Pcdhb22 APN 18 37519921 missense probably damaging 1.00
IGL02232:Pcdhb22 APN 18 37520549 missense probably damaging 1.00
IGL03226:Pcdhb22 APN 18 37518956 missense probably damaging 1.00
R0071:Pcdhb22 UTSW 18 37520078 missense probably damaging 1.00
R0454:Pcdhb22 UTSW 18 37518872 missense probably damaging 0.99
R0624:Pcdhb22 UTSW 18 37518727 missense probably benign 0.00
R0707:Pcdhb22 UTSW 18 37518851 missense probably damaging 1.00
R0918:Pcdhb22 UTSW 18 37520014 missense probably damaging 1.00
R1112:Pcdhb22 UTSW 18 37519768 missense possibly damaging 0.61
R1299:Pcdhb22 UTSW 18 37520590 missense probably damaging 0.99
R1351:Pcdhb22 UTSW 18 37518574 missense probably benign 0.10
R1488:Pcdhb22 UTSW 18 37519888 missense possibly damaging 0.79
R1595:Pcdhb22 UTSW 18 37520453 missense probably damaging 1.00
R1709:Pcdhb22 UTSW 18 37518500 missense probably benign 0.31
R1725:Pcdhb22 UTSW 18 37520188 missense probably benign 0.04
R1869:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1871:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1891:Pcdhb22 UTSW 18 37519304 missense probably damaging 0.97
R4523:Pcdhb22 UTSW 18 37520421 missense probably benign 0.05
R4825:Pcdhb22 UTSW 18 37520660 missense possibly damaging 0.80
R4831:Pcdhb22 UTSW 18 37520562 missense probably damaging 1.00
R4851:Pcdhb22 UTSW 18 37519034 missense possibly damaging 0.89
R4978:Pcdhb22 UTSW 18 37518601 missense probably benign 0.16
R5047:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5061:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5063:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5467:Pcdhb22 UTSW 18 37520135 missense probably benign 0.02
R6005:Pcdhb22 UTSW 18 37519736 missense possibly damaging 0.75
R6375:Pcdhb22 UTSW 18 37518304 intron probably benign
R6418:Pcdhb22 UTSW 18 37519906 missense possibly damaging 0.88
R6447:Pcdhb22 UTSW 18 37520216 missense possibly damaging 0.91
R6748:Pcdhb22 UTSW 18 37518746 missense probably damaging 0.99
R7195:Pcdhb22 UTSW 18 37519288 missense probably damaging 1.00
R7243:Pcdhb22 UTSW 18 37520632 missense probably benign 0.00
X0027:Pcdhb22 UTSW 18 37520851 missense probably benign
Z1088:Pcdhb22 UTSW 18 37519345 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GCACTGCGTTTCTACTCAAAACAGC -3'
(R):5'- ACTTCTCCTGACAGGGCGTTTAGC -3'

Sequencing Primer
(F):5'- CTCAAAACAGCTCAGGATTTGGATG -3'
(R):5'- GCTCATTTCCTGAGAACTGTG -3'
Posted On2013-04-24