Incidental Mutation 'R0364:Grm5'
ID30228
Institutional Source Beutler Lab
Gene Symbol Grm5
Ensembl Gene ENSMUSG00000049583
Gene Nameglutamate receptor, metabotropic 5
SynonymsGlu5R, mGluR5, 6430542K11Rik, Gprc1e
MMRRC Submission 038570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R0364 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location87584168-88134907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88074386 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 628 (Y628C)
Ref Sequence ENSEMBL: ENSMUSP00000114927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]
Predicted Effect probably damaging
Transcript: ENSMUST00000107263
AA Change: Y628C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: Y628C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.4e-97 PFAM
Pfam:Peripla_BP_6 130 332 2.5e-14 PFAM
Pfam:NCD3G 506 557 4.5e-20 PFAM
Pfam:7tm_3 588 824 7.4e-75 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125009
AA Change: Y628C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: Y628C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.7e-101 PFAM
Pfam:Peripla_BP_6 129 327 5.4e-12 PFAM
Pfam:NCD3G 506 557 3.2e-16 PFAM
Pfam:7tm_3 590 823 3.5e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155358
AA Change: Y628C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: Y628C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167164
AA Change: Y628C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129181
Gene: ENSMUSG00000049583
AA Change: Y628C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Arhgef12 A T 9: 43,018,401 N199K probably damaging Het
Arpc2 A G 1: 74,236,887 N26S probably null Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc178 C T 18: 21,915,062 R757H probably damaging Het
Cfap52 A C 11: 67,953,610 I93S possibly damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dnah12 A G 14: 26,724,473 T730A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Endou A T 15: 97,718,973 probably benign Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fbxw17 T C 13: 50,432,441 S40P possibly damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Fyb A G 15: 6,580,791 K282E probably damaging Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Hexa A G 9: 59,563,935 N491D probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hpx G T 7: 105,596,264 Q101K probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b A T 8: 81,997,314 T492S probably benign Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Itga9 A G 9: 118,841,142 T177A probably benign Het
Itpkc A C 7: 27,227,749 S247A possibly damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Kiz T G 2: 146,942,156 S536R probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Kprp A T 3: 92,824,335 Y469* probably null Het
Ksr1 A T 11: 79,029,025 probably benign Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Ltf A T 9: 111,025,167 N350I probably benign Het
Msl3l2 G A 10: 56,115,851 R224Q possibly damaging Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Necap1 A G 6: 122,880,769 probably benign Het
Nf1 A T 11: 79,441,957 K810* probably null Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr850 G A 9: 19,477,972 Q90* probably null Het
Olfr889 A G 9: 38,116,029 T78A probably benign Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Pcdhb17 C A 18: 37,485,835 A226E possibly damaging Het
Phldb1 A T 9: 44,699,335 probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Prr14 G A 7: 127,474,579 R205H probably benign Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Slc7a5 A G 8: 121,885,015 F425L probably benign Het
Slk T A 19: 47,620,189 L527* probably null Het
Stpg4 T A 17: 87,389,714 probably null Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tas2r123 T A 6: 132,847,681 S180R probably benign Het
Tmc2 C T 2: 130,202,103 R86W probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz1 A T 18: 84,016,124 I53N probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Ttll7 C A 3: 146,945,181 R719S possibly damaging Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vps39 T G 2: 120,345,638 K76T probably damaging Het
Wdr60 A G 12: 116,257,477 probably benign Het
Whamm A G 7: 81,594,051 T674A probably benign Het
Zbtb16 A G 9: 48,743,576 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Grm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Grm5 APN 7 88130781 missense probably benign 0.00
IGL00970:Grm5 APN 7 87803896 missense probably damaging 0.97
IGL01286:Grm5 APN 7 87602565 missense probably benign 0.00
IGL01307:Grm5 APN 7 88075012 missense probably damaging 1.00
IGL01603:Grm5 APN 7 87603178 missense probably damaging 1.00
IGL01646:Grm5 APN 7 88040059 missense probably damaging 1.00
IGL01705:Grm5 APN 7 88130046 missense possibly damaging 0.59
IGL02184:Grm5 APN 7 88026442 missense probably damaging 0.98
IGL02504:Grm5 APN 7 88130772 missense probably benign
IGL02689:Grm5 APN 7 87602710 missense probably damaging 1.00
IGL02725:Grm5 APN 7 88074665 missense probably damaging 1.00
IGL02851:Grm5 APN 7 88074710 missense probably damaging 0.98
IGL03106:Grm5 APN 7 88036070 missense probably damaging 1.00
IGL03257:Grm5 APN 7 87602898 missense possibly damaging 0.69
IGL03291:Grm5 APN 7 88130796 missense probably damaging 1.00
R0078:Grm5 UTSW 7 88074977 missense probably damaging 1.00
R0314:Grm5 UTSW 7 87602955 missense probably damaging 0.97
R0318:Grm5 UTSW 7 87602967 missense probably damaging 0.99
R0380:Grm5 UTSW 7 88074376 missense possibly damaging 0.92
R0454:Grm5 UTSW 7 88130789 missense probably damaging 1.00
R0494:Grm5 UTSW 7 88130781 missense probably benign 0.00
R0562:Grm5 UTSW 7 87603019 missense probably damaging 1.00
R1695:Grm5 UTSW 7 88036103 missense possibly damaging 0.47
R2012:Grm5 UTSW 7 88074872 missense probably damaging 1.00
R2384:Grm5 UTSW 7 87602728 missense probably damaging 1.00
R2510:Grm5 UTSW 7 88036091 missense probably benign 0.21
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R3861:Grm5 UTSW 7 88129994 missense possibly damaging 0.94
R4451:Grm5 UTSW 7 88075132 critical splice donor site probably null
R4626:Grm5 UTSW 7 88130153 missense probably damaging 1.00
R4728:Grm5 UTSW 7 87975288 missense probably damaging 1.00
R4914:Grm5 UTSW 7 88130129 missense probably benign 0.00
R5122:Grm5 UTSW 7 88074820 missense probably damaging 1.00
R5352:Grm5 UTSW 7 88074850 missense probably damaging 1.00
R5361:Grm5 UTSW 7 88074496 missense probably damaging 1.00
R5684:Grm5 UTSW 7 88130645 missense probably benign
R5715:Grm5 UTSW 7 88130256 missense probably benign 0.05
R5759:Grm5 UTSW 7 88026600 missense probably damaging 0.96
R5844:Grm5 UTSW 7 87804024 missense possibly damaging 0.88
R5889:Grm5 UTSW 7 87603073 missense probably damaging 1.00
R6048:Grm5 UTSW 7 88026550 missense probably damaging 1.00
R6145:Grm5 UTSW 7 88026601 missense probably damaging 1.00
R6232:Grm5 UTSW 7 87602430 unclassified probably benign
R6972:Grm5 UTSW 7 87602923 missense probably benign 0.02
R7072:Grm5 UTSW 7 88074304 missense probably damaging 1.00
R7258:Grm5 UTSW 7 88074706 missense probably damaging 0.96
R7316:Grm5 UTSW 7 87975265 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCAGCTCCTATCAAACAGCATAC -3'
(R):5'- TGAGCACAGGCGCTCATGAATC -3'

Sequencing Primer
(F):5'- TGTGATTTGATCCCAGTCCAG -3'
(R):5'- CATGAATCTGGGCTTTTTGGTACAG -3'
Posted On2013-04-24