Incidental Mutation 'R0364:Hexa'
ID30239
Institutional Source Beutler Lab
Gene Symbol Hexa
Ensembl Gene ENSMUSG00000025232
Gene Namehexosaminidase A
SynonymsHex-1
MMRRC Submission 038570-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R0364 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59539540-59565109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59563935 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 491 (N491D)
Ref Sequence ENSEMBL: ENSMUSP00000026262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026262]
Predicted Effect probably benign
Transcript: ENSMUST00000026262
AA Change: N491D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026262
Gene: ENSMUSG00000025232
AA Change: N491D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Glycohydro_20b2 23 145 3e-25 PFAM
Pfam:Glyco_hydro_20 167 487 1.6e-88 PFAM
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: This gene encodes a member of the glycosyl hydrolase 20 family of proteins. The encoded preproprotein is proteolytically processed to generate the alpha subunit of the lysosomal enzyme beta-hexosaminidase. This enzyme, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mice lacking the encoded protein exhibit accumulation of gangliosides in the brain and membranous cytoplasmic bodies in neurons. Certain mutations in the human ortholog of this gene cause Tay-Sachs disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants accumulate excess amounts of GM2 ganglioside that is stored in neurons as membranous cytoplasmic bodies typically seen in the neurons of Tay-Sachs disease patients. However, the mutant mice appear to be functionally normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Arhgef12 A T 9: 43,018,401 N199K probably damaging Het
Arpc2 A G 1: 74,236,887 N26S probably null Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc178 C T 18: 21,915,062 R757H probably damaging Het
Cfap52 A C 11: 67,953,610 I93S possibly damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dnah12 A G 14: 26,724,473 T730A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Endou A T 15: 97,718,973 probably benign Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fbxw17 T C 13: 50,432,441 S40P possibly damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Fyb A G 15: 6,580,791 K282E probably damaging Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Grm5 A G 7: 88,074,386 Y628C probably damaging Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hpx G T 7: 105,596,264 Q101K probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b A T 8: 81,997,314 T492S probably benign Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Itga9 A G 9: 118,841,142 T177A probably benign Het
Itpkc A C 7: 27,227,749 S247A possibly damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Kiz T G 2: 146,942,156 S536R probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Kprp A T 3: 92,824,335 Y469* probably null Het
Ksr1 A T 11: 79,029,025 probably benign Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Ltf A T 9: 111,025,167 N350I probably benign Het
Msl3l2 G A 10: 56,115,851 R224Q possibly damaging Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Necap1 A G 6: 122,880,769 probably benign Het
Nf1 A T 11: 79,441,957 K810* probably null Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr850 G A 9: 19,477,972 Q90* probably null Het
Olfr889 A G 9: 38,116,029 T78A probably benign Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Pcdhb17 C A 18: 37,485,835 A226E possibly damaging Het
Phldb1 A T 9: 44,699,335 probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Prr14 G A 7: 127,474,579 R205H probably benign Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Slc7a5 A G 8: 121,885,015 F425L probably benign Het
Slk T A 19: 47,620,189 L527* probably null Het
Stpg4 T A 17: 87,389,714 probably null Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tas2r123 T A 6: 132,847,681 S180R probably benign Het
Tmc2 C T 2: 130,202,103 R86W probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz1 A T 18: 84,016,124 I53N probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Ttll7 C A 3: 146,945,181 R719S possibly damaging Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vps39 T G 2: 120,345,638 K76T probably damaging Het
Wdr60 A G 12: 116,257,477 probably benign Het
Whamm A G 7: 81,594,051 T674A probably benign Het
Zbtb16 A G 9: 48,743,576 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Hexa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Hexa APN 9 59563880 splice site probably benign
IGL02078:Hexa APN 9 59557303 missense probably benign 0.36
R0098:Hexa UTSW 9 59558100 missense probably damaging 1.00
R0098:Hexa UTSW 9 59558100 missense probably damaging 1.00
R0281:Hexa UTSW 9 59554226 critical splice donor site probably null
R0481:Hexa UTSW 9 59555410 splice site probably benign
R1888:Hexa UTSW 9 59557303 missense probably benign 0.36
R1888:Hexa UTSW 9 59557303 missense probably benign 0.36
R2264:Hexa UTSW 9 59555377 missense probably damaging 0.99
R3545:Hexa UTSW 9 59557298 missense probably damaging 0.99
R4609:Hexa UTSW 9 59557319 missense probably benign 0.32
R5777:Hexa UTSW 9 59560960 missense probably damaging 0.99
R6041:Hexa UTSW 9 59563236 missense probably damaging 0.99
R6403:Hexa UTSW 9 59557361 missense probably damaging 1.00
R6776:Hexa UTSW 9 59558072 missense probably damaging 1.00
R6805:Hexa UTSW 9 59563937 missense possibly damaging 0.55
R6912:Hexa UTSW 9 59539938 missense probably damaging 1.00
R7285:Hexa UTSW 9 59563939 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAATGAGGGTGCAACTGAGCCCTG -3'
(R):5'- AGGTTCAAATCCTGCTTCCTGCCG -3'

Sequencing Primer
(F):5'- CAACTGAGCCCTGGAACTG -3'
(R):5'- aatggagacaaaatgttcccac -3'
Posted On2013-04-24