Incidental Mutation 'R0367:Cdc42bpg'
ID30300
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission 038573-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R0367 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6311395 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 317 (C317Y)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: C317Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: C317Y

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,902,114 S12P probably damaging Het
Alx4 T A 2: 93,668,608 D228E probably damaging Het
Antxr2 T C 5: 98,029,596 E71G probably benign Het
Arhgap19 C A 19: 41,801,978 G17V probably benign Het
BC027072 G T 17: 71,750,476 F735L probably damaging Het
C130026I21Rik G T 1: 85,270,103 probably benign Het
C8a A C 4: 104,862,594 probably null Het
Ccne2 T A 4: 11,201,426 probably benign Het
Cend1 C A 7: 141,427,895 R4L probably damaging Het
Cfap44 T C 16: 44,433,476 probably null Het
Cpt1c T C 7: 44,959,575 N774S probably benign Het
Csmd1 C T 8: 15,917,270 D3198N probably damaging Het
Dapk2 C T 9: 66,268,886 S323F probably damaging Het
Ddx60 T G 8: 62,017,749 I1425R possibly damaging Het
Dusp27 T A 1: 166,100,763 T427S probably benign Het
Edem1 T A 6: 108,846,752 Y370N probably damaging Het
Elp5 A G 11: 69,975,141 V103A probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fat1 A G 8: 45,024,313 D2132G probably damaging Het
Fat2 A T 11: 55,292,093 probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gp2 C T 7: 119,454,568 D57N probably damaging Het
Gpr161 T C 1: 165,317,236 probably benign Het
Gstcd G A 3: 132,986,377 probably benign Het
Hipk3 A T 2: 104,431,249 C980* probably null Het
Htr2a A T 14: 74,642,209 I93L probably damaging Het
Itpr2 T G 6: 146,234,008 K1775N probably damaging Het
Kcnt1 G A 2: 25,907,628 V864I probably damaging Het
Kcnt2 A T 1: 140,351,225 Y38F probably damaging Het
Limch1 G A 5: 66,857,954 probably null Het
Lmtk2 C T 5: 144,174,285 R608C possibly damaging Het
Loxhd1 C T 18: 77,425,757 probably benign Het
Lpin2 A T 17: 71,215,022 E17V probably damaging Het
Lrrc34 A T 3: 30,629,993 F342I probably benign Het
Lyzl6 A G 11: 103,636,752 probably null Het
Map3k4 A C 17: 12,258,041 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1263 A C 2: 90,015,772 I281L probably damaging Het
Olfr51 A G 11: 51,007,077 Y35C probably damaging Het
Olfr859 G T 9: 19,808,543 S75I probably damaging Het
Pdzrn4 A G 15: 92,757,657 E477G possibly damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rims2 G T 15: 39,462,615 probably null Het
Samd4b C T 7: 28,423,448 A62T probably damaging Het
Scamp1 T C 13: 94,210,580 N192S probably benign Het
Scnn1g T C 7: 121,746,579 probably benign Het
Setd1a T G 7: 127,788,186 probably benign Het
Setdb1 A G 3: 95,349,881 probably benign Het
Slc2a7 T C 4: 150,166,366 S415P probably benign Het
Strip2 A T 6: 29,937,651 Y526F possibly damaging Het
Syne2 A G 12: 75,880,177 D69G probably damaging Het
Syt13 C A 2: 92,915,251 A22E probably benign Het
Tm9sf2 T C 14: 122,155,368 F432S probably benign Het
Vmn2r49 A T 7: 9,976,430 W792R probably damaging Het
Zfp292 T C 4: 34,808,227 S1606G probably benign Het
Zfp518a A T 19: 40,912,221 H198L probably damaging Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATTCATCAGTCGCAGTTGGGACC -3'
(R):5'- CATCATCCACGTCGAAGTTGGAGG -3'

Sequencing Primer
(F):5'- GGGGAAACACCCTTTTATGC -3'
(R):5'- AAGTTGGAGGTGTCCATCG -3'
Posted On2013-04-24