Incidental Mutation 'R0369:Sf3b1'
ID 30353
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Name splicing factor 3b, subunit 1
Synonyms Prp10, SAP155, SF3b155, 2810001M05Rik, Targ4
MMRRC Submission 038575-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0369 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 55024328-55066640 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55037267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 883 (D883G)
Ref Sequence ENSEMBL: ENSMUSP00000027127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027127
AA Change: D883G

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: D883G

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik G A 9: 114,129,077 (GRCm39) noncoding transcript Het
Aadacl2 T A 3: 59,932,143 (GRCm39) Y219* probably null Het
Adamts13 C A 2: 26,895,198 (GRCm39) D1096E probably benign Het
Adamts16 T G 13: 70,927,671 (GRCm39) K523Q possibly damaging Het
Adcy2 A G 13: 68,820,019 (GRCm39) F740S probably benign Het
Carmil1 T A 13: 24,266,003 (GRCm39) N253I probably damaging Het
Ccdc97 T C 7: 25,413,833 (GRCm39) T283A probably damaging Het
Cmpk2 G T 12: 26,527,150 (GRCm39) E380* probably null Het
Csmd3 A G 15: 47,833,543 (GRCm39) I911T probably damaging Het
Cyp2c39 T C 19: 39,502,079 (GRCm39) L156P probably damaging Het
D7Ertd443e T C 7: 133,899,866 (GRCm39) I499V possibly damaging Het
Dhx58 A C 11: 100,592,374 (GRCm39) probably null Het
Dip2a C T 10: 76,134,621 (GRCm39) G390S probably damaging Het
Dusp10 A G 1: 183,801,253 (GRCm39) D340G probably damaging Het
Epha1 A T 6: 42,342,407 (GRCm39) C314S probably damaging Het
Exph5 A T 9: 53,284,602 (GRCm39) H561L probably benign Het
Fbxw26 A G 9: 109,552,780 (GRCm39) probably null Het
Foxc1 A C 13: 31,991,495 (GRCm39) N102T probably damaging Het
Fsip2 T C 2: 82,814,908 (GRCm39) I3547T probably benign Het
Gm5464 G T 14: 67,106,774 (GRCm39) probably benign Het
Gnptab C T 10: 88,269,456 (GRCm39) R720C possibly damaging Het
Greb1l T C 18: 10,469,375 (GRCm39) V130A possibly damaging Het
Hmg20a A T 9: 56,394,934 (GRCm39) D216V probably damaging Het
Hnrnpul2 C A 19: 8,801,777 (GRCm39) D328E probably damaging Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ift172 T C 5: 31,410,985 (GRCm39) Y1691C probably damaging Het
Kremen2 T C 17: 23,961,784 (GRCm39) D241G probably benign Het
Meis2 T C 2: 115,893,897 (GRCm39) D5G possibly damaging Het
Mrps5 G A 2: 127,433,749 (GRCm39) R46K probably benign Het
Myh14 C T 7: 44,310,374 (GRCm39) V170M probably damaging Het
Nexn T C 3: 151,953,894 (GRCm39) N123D probably benign Het
Or11g26 T A 14: 50,753,282 (GRCm39) M207K probably benign Het
Or4d11 A T 19: 12,013,765 (GRCm39) S114T probably benign Het
Or51l14 T A 7: 103,101,423 (GRCm39) I293N probably damaging Het
Pacs1 C T 19: 5,191,726 (GRCm39) V704M probably damaging Het
Papolg A G 11: 23,822,425 (GRCm39) probably null Het
Pdlim3 T C 8: 46,370,543 (GRCm39) V281A probably benign Het
Plpp4 T G 7: 128,925,190 (GRCm39) F142V probably damaging Het
Prb1a G A 6: 132,184,620 (GRCm39) Q338* probably null Het
Psg26 G T 7: 18,216,481 (GRCm39) Y119* probably null Het
Ptger4 A G 15: 5,272,491 (GRCm39) C68R probably benign Het
Ptpre T A 7: 135,272,444 (GRCm39) I399N probably damaging Het
Ripply2 A G 9: 86,898,372 (GRCm39) Y72C probably damaging Het
Rp1l1 T A 14: 64,266,837 (GRCm39) S808T possibly damaging Het
Scn5a G A 9: 119,362,838 (GRCm39) T594I probably damaging Het
Skint5 A T 4: 113,369,220 (GRCm39) probably null Het
Terf1 A G 1: 15,889,207 (GRCm39) H212R probably damaging Het
Tmco5 T G 2: 116,711,269 (GRCm39) probably null Het
Tnfaip3 A T 10: 18,882,660 (GRCm39) Y252* probably null Het
Tnrc6a T A 7: 122,770,083 (GRCm39) N624K probably damaging Het
Top3a C A 11: 60,633,615 (GRCm39) R827L probably damaging Het
Unc79 G A 12: 103,055,031 (GRCm39) probably null Het
Usp20 T C 2: 30,901,116 (GRCm39) S422P probably benign Het
Utrn T C 10: 12,509,766 (GRCm39) E2402G probably benign Het
Wdr3 G A 3: 100,063,734 (GRCm39) Q181* probably null Het
Zfp536 T C 7: 37,267,373 (GRCm39) E681G probably damaging Het
Zfp91 C T 19: 12,747,438 (GRCm39) V562I possibly damaging Het
Zfp942 A T 17: 22,148,017 (GRCm39) I204N probably benign Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 55,026,645 (GRCm39) missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 55,036,090 (GRCm39) splice site probably benign
IGL01380:Sf3b1 APN 1 55,027,108 (GRCm39) missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 55,026,588 (GRCm39) missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55,046,866 (GRCm39) missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55,051,372 (GRCm39) missense probably benign
Colt UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
Glock UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
Handgun UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
Kalashnikov UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
Magazine UTSW 1 55,051,341 (GRCm39) nonsense probably null
Revolver UTSW 1 55,058,548 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0190:Sf3b1 UTSW 1 55,029,465 (GRCm39) missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0396:Sf3b1 UTSW 1 55,058,430 (GRCm39) missense probably damaging 1.00
R0718:Sf3b1 UTSW 1 55,058,544 (GRCm39) missense probably damaging 0.99
R0991:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1082:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55,042,313 (GRCm39) missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55,040,580 (GRCm39) missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1588:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R1625:Sf3b1 UTSW 1 55,058,536 (GRCm39) missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55,039,811 (GRCm39) missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 55,037,347 (GRCm39) missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55,046,792 (GRCm39) missense probably benign
R2429:Sf3b1 UTSW 1 55,055,960 (GRCm39) missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 55,038,785 (GRCm39) critical splice donor site probably null
R3772:Sf3b1 UTSW 1 55,039,150 (GRCm39) intron probably benign
R3911:Sf3b1 UTSW 1 55,058,548 (GRCm39) nonsense probably null
R3970:Sf3b1 UTSW 1 55,051,341 (GRCm39) nonsense probably null
R4706:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 55,038,871 (GRCm39) missense probably benign
R5053:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55,042,469 (GRCm39) missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55,042,309 (GRCm39) missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 55,037,334 (GRCm39) missense probably benign 0.27
R5636:Sf3b1 UTSW 1 55,036,352 (GRCm39) missense probably damaging 1.00
R6013:Sf3b1 UTSW 1 55,039,457 (GRCm39) missense probably damaging 0.98
R6149:Sf3b1 UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55,046,677 (GRCm39) missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 55,038,814 (GRCm39) missense probably benign 0.01
R6531:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense probably damaging 0.99
R6945:Sf3b1 UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
R7001:Sf3b1 UTSW 1 55,053,640 (GRCm39) critical splice donor site probably null
R7001:Sf3b1 UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
R7302:Sf3b1 UTSW 1 55,055,949 (GRCm39) missense probably benign 0.00
R7644:Sf3b1 UTSW 1 55,036,302 (GRCm39) nonsense probably null
R7664:Sf3b1 UTSW 1 55,026,626 (GRCm39) missense probably damaging 1.00
R7735:Sf3b1 UTSW 1 55,042,508 (GRCm39) missense probably benign 0.29
R7809:Sf3b1 UTSW 1 55,034,614 (GRCm39) missense possibly damaging 0.60
R8516:Sf3b1 UTSW 1 55,051,262 (GRCm39) missense probably null 0.01
R8871:Sf3b1 UTSW 1 55,029,508 (GRCm39) missense probably damaging 1.00
R8947:Sf3b1 UTSW 1 55,039,444 (GRCm39) missense probably damaging 1.00
R9216:Sf3b1 UTSW 1 55,051,376 (GRCm39) missense probably benign 0.00
Z1177:Sf3b1 UTSW 1 55,042,561 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGTTAAACTGAGGACAACTGGTCACT -3'
(R):5'- AGTTGATACAACTGTGGAGTTGGCAAA -3'

Sequencing Primer
(F):5'- caggagacaagtggtgatagg -3'
(R):5'- TTGGCAAACAAAGTAGGTGC -3'
Posted On 2013-04-24