Incidental Mutation 'R0369:Exph5'
ID 30379
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Name exophilin 5
Synonyms AC079869.22gm5, Slac2b, slac2-b, B130009M24Rik
MMRRC Submission 038575-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0369 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 53212970-53288814 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53284602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 561 (H561L)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
AlphaFold Q0VAV2
Predicted Effect probably benign
Transcript: ENSMUST00000051014
AA Change: H561L

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: H561L

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132410
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik G A 9: 114,129,077 (GRCm39) noncoding transcript Het
Aadacl2 T A 3: 59,932,143 (GRCm39) Y219* probably null Het
Adamts13 C A 2: 26,895,198 (GRCm39) D1096E probably benign Het
Adamts16 T G 13: 70,927,671 (GRCm39) K523Q possibly damaging Het
Adcy2 A G 13: 68,820,019 (GRCm39) F740S probably benign Het
Carmil1 T A 13: 24,266,003 (GRCm39) N253I probably damaging Het
Ccdc97 T C 7: 25,413,833 (GRCm39) T283A probably damaging Het
Cmpk2 G T 12: 26,527,150 (GRCm39) E380* probably null Het
Csmd3 A G 15: 47,833,543 (GRCm39) I911T probably damaging Het
Cyp2c39 T C 19: 39,502,079 (GRCm39) L156P probably damaging Het
D7Ertd443e T C 7: 133,899,866 (GRCm39) I499V possibly damaging Het
Dhx58 A C 11: 100,592,374 (GRCm39) probably null Het
Dip2a C T 10: 76,134,621 (GRCm39) G390S probably damaging Het
Dusp10 A G 1: 183,801,253 (GRCm39) D340G probably damaging Het
Epha1 A T 6: 42,342,407 (GRCm39) C314S probably damaging Het
Fbxw26 A G 9: 109,552,780 (GRCm39) probably null Het
Foxc1 A C 13: 31,991,495 (GRCm39) N102T probably damaging Het
Fsip2 T C 2: 82,814,908 (GRCm39) I3547T probably benign Het
Gm5464 G T 14: 67,106,774 (GRCm39) probably benign Het
Gnptab C T 10: 88,269,456 (GRCm39) R720C possibly damaging Het
Greb1l T C 18: 10,469,375 (GRCm39) V130A possibly damaging Het
Hmg20a A T 9: 56,394,934 (GRCm39) D216V probably damaging Het
Hnrnpul2 C A 19: 8,801,777 (GRCm39) D328E probably damaging Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ift172 T C 5: 31,410,985 (GRCm39) Y1691C probably damaging Het
Kremen2 T C 17: 23,961,784 (GRCm39) D241G probably benign Het
Meis2 T C 2: 115,893,897 (GRCm39) D5G possibly damaging Het
Mrps5 G A 2: 127,433,749 (GRCm39) R46K probably benign Het
Myh14 C T 7: 44,310,374 (GRCm39) V170M probably damaging Het
Nexn T C 3: 151,953,894 (GRCm39) N123D probably benign Het
Or11g26 T A 14: 50,753,282 (GRCm39) M207K probably benign Het
Or4d11 A T 19: 12,013,765 (GRCm39) S114T probably benign Het
Or51l14 T A 7: 103,101,423 (GRCm39) I293N probably damaging Het
Pacs1 C T 19: 5,191,726 (GRCm39) V704M probably damaging Het
Papolg A G 11: 23,822,425 (GRCm39) probably null Het
Pdlim3 T C 8: 46,370,543 (GRCm39) V281A probably benign Het
Plpp4 T G 7: 128,925,190 (GRCm39) F142V probably damaging Het
Prb1a G A 6: 132,184,620 (GRCm39) Q338* probably null Het
Psg26 G T 7: 18,216,481 (GRCm39) Y119* probably null Het
Ptger4 A G 15: 5,272,491 (GRCm39) C68R probably benign Het
Ptpre T A 7: 135,272,444 (GRCm39) I399N probably damaging Het
Ripply2 A G 9: 86,898,372 (GRCm39) Y72C probably damaging Het
Rp1l1 T A 14: 64,266,837 (GRCm39) S808T possibly damaging Het
Scn5a G A 9: 119,362,838 (GRCm39) T594I probably damaging Het
Sf3b1 T C 1: 55,037,267 (GRCm39) D883G probably benign Het
Skint5 A T 4: 113,369,220 (GRCm39) probably null Het
Terf1 A G 1: 15,889,207 (GRCm39) H212R probably damaging Het
Tmco5 T G 2: 116,711,269 (GRCm39) probably null Het
Tnfaip3 A T 10: 18,882,660 (GRCm39) Y252* probably null Het
Tnrc6a T A 7: 122,770,083 (GRCm39) N624K probably damaging Het
Top3a C A 11: 60,633,615 (GRCm39) R827L probably damaging Het
Unc79 G A 12: 103,055,031 (GRCm39) probably null Het
Usp20 T C 2: 30,901,116 (GRCm39) S422P probably benign Het
Utrn T C 10: 12,509,766 (GRCm39) E2402G probably benign Het
Wdr3 G A 3: 100,063,734 (GRCm39) Q181* probably null Het
Zfp536 T C 7: 37,267,373 (GRCm39) E681G probably damaging Het
Zfp91 C T 19: 12,747,438 (GRCm39) V562I possibly damaging Het
Zfp942 A T 17: 22,148,017 (GRCm39) I204N probably benign Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53,288,006 (GRCm39) nonsense probably null
IGL01387:Exph5 APN 9 53,285,265 (GRCm39) missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53,287,869 (GRCm39) missense probably damaging 0.99
IGL02122:Exph5 APN 9 53,284,974 (GRCm39) missense probably benign 0.05
IGL02156:Exph5 APN 9 53,286,941 (GRCm39) missense probably damaging 0.96
IGL02192:Exph5 APN 9 53,287,625 (GRCm39) nonsense probably null
IGL02491:Exph5 APN 9 53,286,343 (GRCm39) missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53,286,278 (GRCm39) missense probably damaging 0.96
R0002:Exph5 UTSW 9 53,285,256 (GRCm39) missense probably damaging 0.99
R0026:Exph5 UTSW 9 53,287,779 (GRCm39) missense probably benign 0.38
R0086:Exph5 UTSW 9 53,249,230 (GRCm39) missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53,264,504 (GRCm39) critical splice donor site probably null
R0409:Exph5 UTSW 9 53,285,643 (GRCm39) missense probably benign 0.00
R0517:Exph5 UTSW 9 53,284,062 (GRCm39) missense probably benign 0.02
R0658:Exph5 UTSW 9 53,288,775 (GRCm39) missense unknown
R1606:Exph5 UTSW 9 53,285,595 (GRCm39) missense probably benign 0.37
R1739:Exph5 UTSW 9 53,286,888 (GRCm39) missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53,285,109 (GRCm39) missense probably benign 0.35
R1828:Exph5 UTSW 9 53,287,941 (GRCm39) missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53,287,548 (GRCm39) missense probably benign
R1993:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53,278,466 (GRCm39) missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53,283,979 (GRCm39) missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53,286,225 (GRCm39) nonsense probably null
R3817:Exph5 UTSW 9 53,286,794 (GRCm39) nonsense probably null
R4771:Exph5 UTSW 9 53,284,965 (GRCm39) missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53,287,539 (GRCm39) missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53,287,925 (GRCm39) missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53,286,910 (GRCm39) missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53,249,230 (GRCm39) missense probably damaging 0.99
R5522:Exph5 UTSW 9 53,285,613 (GRCm39) missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53,286,522 (GRCm39) missense probably benign 0.04
R5961:Exph5 UTSW 9 53,288,555 (GRCm39) missense probably damaging 1.00
R6093:Exph5 UTSW 9 53,283,917 (GRCm39) missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53,284,328 (GRCm39) missense probably benign 0.21
R6254:Exph5 UTSW 9 53,284,010 (GRCm39) missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53,287,991 (GRCm39) missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53,213,012 (GRCm39) start gained probably benign
R6792:Exph5 UTSW 9 53,286,617 (GRCm39) missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53,251,728 (GRCm39) missense probably benign 0.27
R7340:Exph5 UTSW 9 53,288,309 (GRCm39) missense probably damaging 0.99
R7347:Exph5 UTSW 9 53,287,196 (GRCm39) missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53,287,022 (GRCm39) missense probably benign 0.00
R7520:Exph5 UTSW 9 53,278,514 (GRCm39) critical splice donor site probably null
R7521:Exph5 UTSW 9 53,285,377 (GRCm39) missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53,287,073 (GRCm39) missense probably benign 0.41
R7581:Exph5 UTSW 9 53,283,857 (GRCm39) missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53,284,475 (GRCm39) missense possibly damaging 0.62
R7976:Exph5 UTSW 9 53,287,935 (GRCm39) missense possibly damaging 0.79
R8017:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8019:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8302:Exph5 UTSW 9 53,287,776 (GRCm39) missense possibly damaging 0.89
R8420:Exph5 UTSW 9 53,287,148 (GRCm39) nonsense probably null
R8551:Exph5 UTSW 9 53,285,351 (GRCm39) missense possibly damaging 0.94
R8708:Exph5 UTSW 9 53,287,096 (GRCm39) missense probably benign
R8889:Exph5 UTSW 9 53,287,955 (GRCm39) missense probably damaging 1.00
R9048:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R9255:Exph5 UTSW 9 53,284,609 (GRCm39) missense possibly damaging 0.79
R9727:Exph5 UTSW 9 53,287,702 (GRCm39) missense probably damaging 0.96
X0028:Exph5 UTSW 9 53,287,563 (GRCm39) missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53,288,719 (GRCm39) missense probably benign
Z1177:Exph5 UTSW 9 53,285,513 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGCCATTCTACCGTCAGAGTAACCC -3'
(R):5'- GAATGAAGATGCTGGAGTCTGAGCC -3'

Sequencing Primer
(F):5'- TTTAGCAGTACCTTCAGACAGAGC -3'
(R):5'- AGTCTGAGCCTTGCCACAC -3'
Posted On 2013-04-24