Mutagenetix > Incidental Mutation

Incidental Mutation 'R0370:Grid2'

30422

Institutional Source

Beutler Lab

Gene Symbol

Grid2

Ensembl Gene

ENSMUSG00000071424

Gene Name

glutamate receptor, ionotropic, delta 2

Synonyms

tpr, B230104L07Rik, GluRdelta2

MMRRC Submission

038576-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0370 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63232860-64681307 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64322718 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 573 (I573V)

Ref Sequence

ENSEMBL: ENSMUSP00000093536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095852]

AlphaFold

Q61625

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095852
AA Change: I573V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: I573V

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l1	T	C	8: 124,228,293 (GRCm39)	S666P	probably damaging	Het
B3gntl1	A	T	11: 121,514,980 (GRCm39)	W263R	probably damaging	Het
Carmil3	A	G	14: 55,732,899 (GRCm39)	N270S	possibly damaging	Het
Ctdp1	T	C	18: 80,492,569 (GRCm39)	E642G	probably damaging	Het
Cyp2b9	A	T	7: 25,909,531 (GRCm39)	K433M	probably damaging	Het
Dcc	A	G	18: 71,721,056 (GRCm39)	V435A	possibly damaging	Het
Defa26	A	T	8: 22,108,875 (GRCm39)	M87L	probably benign	Het
Dnah11	T	A	12: 117,958,962 (GRCm39)	I2974L	probably benign	Het
Dnah3	T	C	7: 119,685,943 (GRCm39)	D131G	possibly damaging	Het
Dock6	A	T	9: 21,725,861 (GRCm39)	S1447R	probably benign	Het
Dtl	G	T	1: 191,307,462 (GRCm39)	N17K	probably benign	Het
Hoxa9	T	C	6: 52,202,684 (GRCm39)	E134G	possibly damaging	Het
Kcnn3	A	T	3: 89,574,399 (GRCm39)	N637I	probably damaging	Het
Ktn1	T	C	14: 47,901,532 (GRCm39)	F97L	probably benign	Het
Lmbrd2	T	C	15: 9,165,939 (GRCm39)	I271T	probably damaging	Het
Lrp6	A	C	6: 134,456,729 (GRCm39)	I845S	probably damaging	Het
Med13l	T	A	5: 118,879,891 (GRCm39)	N994K	probably benign	Het
Mrrf	A	T	2: 36,067,125 (GRCm39)		probably null	Het
Mtmr1	G	A	X: 70,431,837 (GRCm39)	V125I	probably damaging	Het
Nol8	C	T	13: 49,815,923 (GRCm39)	A677V	possibly damaging	Het
Or13g1	T	A	7: 85,956,057 (GRCm39)	N88I	probably benign	Het
Or51k1	T	G	7: 103,661,266 (GRCm39)	L214F	probably damaging	Het
Or8k3	A	T	2: 86,059,057 (GRCm39)	V86D	probably damaging	Het
Paxip1	C	A	5: 27,965,084 (GRCm39)	V659F	probably damaging	Het
Pclo	T	C	5: 14,571,104 (GRCm39)	V163A	probably damaging	Het
Pkn3	T	A	2: 29,977,184 (GRCm39)	H641Q	probably damaging	Het
Plekhg6	G	A	6: 125,347,623 (GRCm39)	R444C	probably damaging	Het
Rfx2	T	C	17: 57,106,308 (GRCm39)	E175G	probably benign	Het
Samd9l	A	C	6: 3,377,264 (GRCm39)		probably benign	Het
Sec14l5	A	T	16: 4,998,570 (GRCm39)	T537S	probably damaging	Het
Serpinb9d	A	G	13: 33,379,949 (GRCm39)	E96G	probably damaging	Het
Setd4	T	C	16: 93,388,006 (GRCm39)	E160G	probably damaging	Het
Sf3b2	C	T	19: 5,324,852 (GRCm39)	D845N	probably damaging	Het
Slc16a4	A	G	3: 107,208,413 (GRCm39)	I308V	possibly damaging	Het
Slco2b1	T	A	7: 99,339,644 (GRCm39)	N100Y	probably damaging	Het
Sptbn1	A	T	11: 30,071,545 (GRCm39)	S1475R	probably benign	Het
Tecta	T	C	9: 42,278,100 (GRCm39)	D1136G	probably benign	Het
Tmem94	G	C	11: 115,679,543 (GRCm39)	R273S	probably damaging	Het
Tns3	A	G	11: 8,395,730 (GRCm39)	S1225P	possibly damaging	Het
Ugt2b36	A	G	5: 87,239,834 (GRCm39)	Y184H	probably benign	Het
Vmn2r59	A	T	7: 41,662,150 (GRCm39)	M555K	probably benign	Het

Other mutations in Grid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Grid2	APN	6	64,322,573 (GRCm39)	missense	probably damaging	1.00
IGL00596:Grid2	APN	6	64,510,688 (GRCm39)	missense	possibly damaging	0.93
IGL01686:Grid2	APN	6	64,297,180 (GRCm39)	missense	probably benign	0.00
IGL01712:Grid2	APN	6	64,642,899 (GRCm39)	missense	possibly damaging	0.73
IGL02064:Grid2	APN	6	64,040,919 (GRCm39)	missense	probably benign	0.29
IGL02216:Grid2	APN	6	64,322,650 (GRCm39)	missense	probably damaging	0.96
IGL02563:Grid2	APN	6	64,322,857 (GRCm39)	missense	possibly damaging	0.94
IGL02685:Grid2	APN	6	64,322,800 (GRCm39)	missense	possibly damaging	0.50
IGL03129:Grid2	APN	6	64,040,888 (GRCm39)	missense	probably damaging	0.98
IGL03324:Grid2	APN	6	64,406,806 (GRCm39)	missense	possibly damaging	0.88
IGL03395:Grid2	APN	6	63,886,053 (GRCm39)	missense	possibly damaging	0.94
crawler	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
swagger	UTSW	6	64,372,263 (GRCm39)	synonymous	probably benign
R0133:Grid2	UTSW	6	64,297,116 (GRCm39)	missense	probably damaging	1.00
R0147:Grid2	UTSW	6	64,510,571 (GRCm39)	missense	probably benign
R0193:Grid2	UTSW	6	64,040,937 (GRCm39)	missense	possibly damaging	0.64
R0399:Grid2	UTSW	6	64,643,036 (GRCm39)	missense	probably benign	0.33
R0600:Grid2	UTSW	6	63,480,419 (GRCm39)	missense	probably benign	0.38
R0717:Grid2	UTSW	6	64,643,259 (GRCm39)	missense	possibly damaging	0.96
R1524:Grid2	UTSW	6	64,406,738 (GRCm39)	missense	possibly damaging	0.92
R1555:Grid2	UTSW	6	64,406,668 (GRCm39)	missense	possibly damaging	0.87
R1572:Grid2	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
R1762:Grid2	UTSW	6	64,510,638 (GRCm39)	missense	probably damaging	0.98
R1944:Grid2	UTSW	6	63,886,045 (GRCm39)	missense	probably damaging	1.00
R1961:Grid2	UTSW	6	63,885,877 (GRCm39)	missense	probably damaging	1.00
R1969:Grid2	UTSW	6	63,885,902 (GRCm39)	nonsense	probably null
R2138:Grid2	UTSW	6	64,322,782 (GRCm39)	missense	probably damaging	0.99
R3500:Grid2	UTSW	6	63,480,383 (GRCm39)	missense	probably damaging	0.97
R3547:Grid2	UTSW	6	64,297,005 (GRCm39)	missense	probably damaging	0.97
R3845:Grid2	UTSW	6	64,322,826 (GRCm39)	missense	possibly damaging	0.62
R4124:Grid2	UTSW	6	63,480,417 (GRCm39)	missense	probably benign	0.41
R4273:Grid2	UTSW	6	63,886,029 (GRCm39)	missense	probably damaging	1.00
R4591:Grid2	UTSW	6	64,297,086 (GRCm39)	missense	probably damaging	1.00
R4701:Grid2	UTSW	6	64,642,899 (GRCm39)	missense	probably benign	0.27
R4721:Grid2	UTSW	6	64,643,185 (GRCm39)	missense	probably benign	0.33
R4755:Grid2	UTSW	6	63,885,972 (GRCm39)	missense	probably benign	0.04
R4869:Grid2	UTSW	6	64,406,724 (GRCm39)	missense	probably damaging	1.00
R5083:Grid2	UTSW	6	64,297,136 (GRCm39)	nonsense	probably null
R5091:Grid2	UTSW	6	64,053,862 (GRCm39)	missense	probably benign	0.07
R5117:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R5128:Grid2	UTSW	6	64,642,982 (GRCm39)	missense	probably benign	0.01
R5386:Grid2	UTSW	6	63,908,089 (GRCm39)	missense	probably damaging	0.99
R5404:Grid2	UTSW	6	63,907,894 (GRCm39)	missense	probably damaging	0.99
R5534:Grid2	UTSW	6	63,480,345 (GRCm39)	missense	probably benign
R5626:Grid2	UTSW	6	64,053,929 (GRCm39)	critical splice donor site	probably null
R5699:Grid2	UTSW	6	63,885,975 (GRCm39)	missense	probably damaging	0.99
R5700:Grid2	UTSW	6	64,071,416 (GRCm39)	missense	possibly damaging	0.95
R5876:Grid2	UTSW	6	64,640,146 (GRCm39)	missense	probably damaging	1.00
R6446:Grid2	UTSW	6	64,322,577 (GRCm39)	missense	probably damaging	1.00
R6694:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6697:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6699:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6767:Grid2	UTSW	6	63,907,999 (GRCm39)	missense	probably benign	0.01
R6895:Grid2	UTSW	6	64,372,283 (GRCm39)	missense	probably damaging	0.99
R6999:Grid2	UTSW	6	64,053,893 (GRCm39)	missense	possibly damaging	0.80
R7053:Grid2	UTSW	6	64,677,402 (GRCm39)	missense	unknown
R7126:Grid2	UTSW	6	64,053,794 (GRCm39)	missense	probably damaging	0.99
R7432:Grid2	UTSW	6	64,252,854 (GRCm39)	missense	possibly damaging	0.46
R7553:Grid2	UTSW	6	64,053,925 (GRCm39)	missense	possibly damaging	0.95
R7619:Grid2	UTSW	6	63,908,085 (GRCm39)	missense	possibly damaging	0.71
R7997:Grid2	UTSW	6	64,297,120 (GRCm39)	missense	possibly damaging	0.89
R8112:Grid2	UTSW	6	63,885,891 (GRCm39)	missense	probably damaging	0.99
R8296:Grid2	UTSW	6	63,233,929 (GRCm39)	critical splice donor site	probably null
R8320:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R8467:Grid2	UTSW	6	64,510,635 (GRCm39)	missense	probably benign	0.01
R8691:Grid2	UTSW	6	63,480,321 (GRCm39)	missense	probably damaging	0.97
R8890:Grid2	UTSW	6	63,233,923 (GRCm39)	missense	probably benign
R8965:Grid2	UTSW	6	64,296,990 (GRCm39)	missense	probably damaging	1.00
R8968:Grid2	UTSW	6	64,643,139 (GRCm39)	missense	probably benign	0.14
R9220:Grid2	UTSW	6	63,885,888 (GRCm39)	missense	probably damaging	1.00
R9371:Grid2	UTSW	6	64,677,506 (GRCm39)	missense	unknown
R9653:Grid2	UTSW	6	63,907,968 (GRCm39)	missense	possibly damaging	0.75
Z1176:Grid2	UTSW	6	64,640,212 (GRCm39)	missense	probably benign	0.03
Z1176:Grid2	UTSW	6	63,885,863 (GRCm39)	missense	possibly damaging	0.76
Z1177:Grid2	UTSW	6	64,322,841 (GRCm39)	missense	probably damaging	1.00
Z1177:Grid2	UTSW	6	64,322,840 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAGCGTGTCTATAAGAAGTCCCTGC -3'
(R):5'- AAGCCTGCTATGCCTGAGATCCAC -3'

Sequencing Primer
(F):5'- TTCAATTTCCCAGAGAGCTGAC -3'
(R):5'- GGAAATGTTATCTTCTGAGCACTGC -3'

Posted On

2013-04-24