Incidental Mutation 'R0370:Sptbn1'
ID 30437
Institutional Source Beutler Lab
Gene Symbol Sptbn1
Ensembl Gene ENSMUSG00000020315
Gene Name spectrin beta, non-erythrocytic 1
Synonyms beta fodrin, Spnb-2, 9930031C03Rik, spectrin G, elf1, brain spectrin, elf3, Spnb2, non-erythrocytic
MMRRC Submission 038576-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0370 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 30049395-30218175 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30071545 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1475 (S1475R)
Ref Sequence ENSEMBL: ENSMUSP00000114841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]
AlphaFold Q62261
Predicted Effect probably benign
Transcript: ENSMUST00000006629
AA Change: S1475R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: S1475R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011877
AA Change: S1475R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: S1475R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102838
AA Change: S1462R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: S1462R

DomainStartEndE-ValueType
CH 43 143 3.02e-28 SMART
CH 162 260 8.73e-25 SMART
SPEC 292 398 2.03e0 SMART
SPEC 412 512 6.42e-26 SMART
SPEC 518 622 4.61e-27 SMART
SPEC 628 728 2.36e-33 SMART
SPEC 734 833 1.2e-25 SMART
SPEC 839 939 7.16e-24 SMART
SPEC 945 1046 6.58e-23 SMART
SPEC 1052 1153 1.79e-24 SMART
SPEC 1159 1259 2.2e-24 SMART
SPEC 1265 1364 5.18e-21 SMART
SPEC 1370 1469 1.02e-19 SMART
SPEC 1475 1576 7.2e-29 SMART
SPEC 1582 1682 8.03e-27 SMART
SPEC 1688 1789 9.73e-26 SMART
SPEC 1795 1895 9.82e-22 SMART
SPEC 1901 2001 8.68e-23 SMART
SPEC 2007 2114 2.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124231
AA Change: S1475R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: S1475R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2092 6.42e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 124,228,293 (GRCm39) S666P probably damaging Het
B3gntl1 A T 11: 121,514,980 (GRCm39) W263R probably damaging Het
Carmil3 A G 14: 55,732,899 (GRCm39) N270S possibly damaging Het
Ctdp1 T C 18: 80,492,569 (GRCm39) E642G probably damaging Het
Cyp2b9 A T 7: 25,909,531 (GRCm39) K433M probably damaging Het
Dcc A G 18: 71,721,056 (GRCm39) V435A possibly damaging Het
Defa26 A T 8: 22,108,875 (GRCm39) M87L probably benign Het
Dnah11 T A 12: 117,958,962 (GRCm39) I2974L probably benign Het
Dnah3 T C 7: 119,685,943 (GRCm39) D131G possibly damaging Het
Dock6 A T 9: 21,725,861 (GRCm39) S1447R probably benign Het
Dtl G T 1: 191,307,462 (GRCm39) N17K probably benign Het
Grid2 A G 6: 64,322,718 (GRCm39) I573V possibly damaging Het
Hoxa9 T C 6: 52,202,684 (GRCm39) E134G possibly damaging Het
Kcnn3 A T 3: 89,574,399 (GRCm39) N637I probably damaging Het
Ktn1 T C 14: 47,901,532 (GRCm39) F97L probably benign Het
Lmbrd2 T C 15: 9,165,939 (GRCm39) I271T probably damaging Het
Lrp6 A C 6: 134,456,729 (GRCm39) I845S probably damaging Het
Med13l T A 5: 118,879,891 (GRCm39) N994K probably benign Het
Mrrf A T 2: 36,067,125 (GRCm39) probably null Het
Mtmr1 G A X: 70,431,837 (GRCm39) V125I probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Or13g1 T A 7: 85,956,057 (GRCm39) N88I probably benign Het
Or51k1 T G 7: 103,661,266 (GRCm39) L214F probably damaging Het
Or8k3 A T 2: 86,059,057 (GRCm39) V86D probably damaging Het
Paxip1 C A 5: 27,965,084 (GRCm39) V659F probably damaging Het
Pclo T C 5: 14,571,104 (GRCm39) V163A probably damaging Het
Pkn3 T A 2: 29,977,184 (GRCm39) H641Q probably damaging Het
Plekhg6 G A 6: 125,347,623 (GRCm39) R444C probably damaging Het
Rfx2 T C 17: 57,106,308 (GRCm39) E175G probably benign Het
Samd9l A C 6: 3,377,264 (GRCm39) probably benign Het
Sec14l5 A T 16: 4,998,570 (GRCm39) T537S probably damaging Het
Serpinb9d A G 13: 33,379,949 (GRCm39) E96G probably damaging Het
Setd4 T C 16: 93,388,006 (GRCm39) E160G probably damaging Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Slc16a4 A G 3: 107,208,413 (GRCm39) I308V possibly damaging Het
Slco2b1 T A 7: 99,339,644 (GRCm39) N100Y probably damaging Het
Tecta T C 9: 42,278,100 (GRCm39) D1136G probably benign Het
Tmem94 G C 11: 115,679,543 (GRCm39) R273S probably damaging Het
Tns3 A G 11: 8,395,730 (GRCm39) S1225P possibly damaging Het
Ugt2b36 A G 5: 87,239,834 (GRCm39) Y184H probably benign Het
Vmn2r59 A T 7: 41,662,150 (GRCm39) M555K probably benign Het
Other mutations in Sptbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sptbn1 APN 11 30,060,818 (GRCm39) nonsense probably null
IGL01098:Sptbn1 APN 11 30,109,385 (GRCm39) missense probably damaging 1.00
IGL01843:Sptbn1 APN 11 30,054,623 (GRCm39) missense probably benign 0.02
IGL02070:Sptbn1 APN 11 30,095,979 (GRCm39) missense probably damaging 0.99
IGL02075:Sptbn1 APN 11 30,088,496 (GRCm39) missense probably damaging 1.00
IGL02094:Sptbn1 APN 11 30,050,659 (GRCm39) missense probably benign 0.01
IGL02102:Sptbn1 APN 11 30,087,427 (GRCm39) missense probably damaging 1.00
IGL02189:Sptbn1 APN 11 30,067,871 (GRCm39) missense probably damaging 1.00
IGL02256:Sptbn1 APN 11 30,070,990 (GRCm39) missense probably benign 0.24
IGL02301:Sptbn1 APN 11 30,092,129 (GRCm39) missense probably damaging 1.00
IGL02354:Sptbn1 APN 11 30,060,783 (GRCm39) missense probably damaging 1.00
IGL02361:Sptbn1 APN 11 30,060,783 (GRCm39) missense probably damaging 1.00
IGL02377:Sptbn1 APN 11 30,069,491 (GRCm39) missense possibly damaging 0.92
IGL02504:Sptbn1 APN 11 30,092,293 (GRCm39) missense probably damaging 1.00
IGL02672:Sptbn1 APN 11 30,087,239 (GRCm39) missense probably damaging 1.00
IGL02733:Sptbn1 APN 11 30,147,747 (GRCm39) missense probably benign 0.12
IGL02755:Sptbn1 APN 11 30,092,247 (GRCm39) missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30,073,855 (GRCm39) missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30,073,855 (GRCm39) missense probably damaging 1.00
R0096:Sptbn1 UTSW 11 30,064,739 (GRCm39) missense probably damaging 1.00
R0139:Sptbn1 UTSW 11 30,092,289 (GRCm39) missense probably benign 0.00
R0389:Sptbn1 UTSW 11 30,089,250 (GRCm39) missense possibly damaging 0.95
R0415:Sptbn1 UTSW 11 30,099,576 (GRCm39) missense probably damaging 1.00
R0552:Sptbn1 UTSW 11 30,095,985 (GRCm39) missense possibly damaging 0.92
R0601:Sptbn1 UTSW 11 30,100,008 (GRCm39) missense probably damaging 1.00
R0609:Sptbn1 UTSW 11 30,088,979 (GRCm39) missense probably damaging 1.00
R0675:Sptbn1 UTSW 11 30,067,903 (GRCm39) missense probably damaging 1.00
R0708:Sptbn1 UTSW 11 30,064,739 (GRCm39) missense probably damaging 1.00
R0711:Sptbn1 UTSW 11 30,064,739 (GRCm39) missense probably damaging 1.00
R0729:Sptbn1 UTSW 11 30,060,902 (GRCm39) missense probably damaging 0.96
R0755:Sptbn1 UTSW 11 30,089,016 (GRCm39) missense probably damaging 1.00
R0892:Sptbn1 UTSW 11 30,092,201 (GRCm39) missense probably damaging 1.00
R0927:Sptbn1 UTSW 11 30,071,591 (GRCm39) missense probably damaging 1.00
R1102:Sptbn1 UTSW 11 30,070,785 (GRCm39) missense possibly damaging 0.93
R1460:Sptbn1 UTSW 11 30,088,637 (GRCm39) missense possibly damaging 0.50
R1479:Sptbn1 UTSW 11 30,063,909 (GRCm39) missense probably damaging 1.00
R1496:Sptbn1 UTSW 11 30,071,498 (GRCm39) missense probably damaging 1.00
R1649:Sptbn1 UTSW 11 30,087,301 (GRCm39) missense probably damaging 0.97
R1663:Sptbn1 UTSW 11 30,070,783 (GRCm39) missense possibly damaging 0.53
R1671:Sptbn1 UTSW 11 30,092,245 (GRCm39) missense possibly damaging 0.57
R1680:Sptbn1 UTSW 11 30,109,371 (GRCm39) missense possibly damaging 0.92
R1695:Sptbn1 UTSW 11 30,086,124 (GRCm39) missense probably benign 0.13
R1868:Sptbn1 UTSW 11 30,064,781 (GRCm39) missense possibly damaging 0.70
R1918:Sptbn1 UTSW 11 30,092,414 (GRCm39) missense probably damaging 1.00
R1921:Sptbn1 UTSW 11 30,054,469 (GRCm39) missense probably damaging 0.98
R2026:Sptbn1 UTSW 11 30,054,559 (GRCm39) missense probably benign 0.02
R2038:Sptbn1 UTSW 11 30,109,293 (GRCm39) critical splice donor site probably null
R2047:Sptbn1 UTSW 11 30,088,360 (GRCm39) splice site probably benign
R2312:Sptbn1 UTSW 11 30,104,249 (GRCm39) missense probably damaging 1.00
R3430:Sptbn1 UTSW 11 30,169,686 (GRCm39) missense possibly damaging 0.67
R3624:Sptbn1 UTSW 11 30,090,593 (GRCm39) missense probably damaging 1.00
R3723:Sptbn1 UTSW 11 30,087,335 (GRCm39) missense possibly damaging 0.59
R3862:Sptbn1 UTSW 11 30,092,329 (GRCm39) missense possibly damaging 0.63
R4446:Sptbn1 UTSW 11 30,089,114 (GRCm39) missense possibly damaging 0.70
R4582:Sptbn1 UTSW 11 30,169,597 (GRCm39) missense probably damaging 1.00
R4705:Sptbn1 UTSW 11 30,050,660 (GRCm39) missense probably benign
R4707:Sptbn1 UTSW 11 30,087,197 (GRCm39) missense possibly damaging 0.61
R4718:Sptbn1 UTSW 11 30,104,297 (GRCm39) missense probably damaging 1.00
R4789:Sptbn1 UTSW 11 30,067,759 (GRCm39) missense probably benign
R4824:Sptbn1 UTSW 11 30,068,295 (GRCm39) missense possibly damaging 0.72
R4855:Sptbn1 UTSW 11 30,092,353 (GRCm39) missense probably damaging 1.00
R5009:Sptbn1 UTSW 11 30,074,016 (GRCm39) missense probably benign 0.05
R5071:Sptbn1 UTSW 11 30,063,854 (GRCm39) critical splice donor site probably null
R5153:Sptbn1 UTSW 11 30,071,510 (GRCm39) missense possibly damaging 0.82
R5334:Sptbn1 UTSW 11 30,087,364 (GRCm39) missense possibly damaging 0.92
R5462:Sptbn1 UTSW 11 30,050,520 (GRCm39) missense possibly damaging 0.94
R5523:Sptbn1 UTSW 11 30,087,560 (GRCm39) missense probably damaging 1.00
R5707:Sptbn1 UTSW 11 30,093,174 (GRCm39) missense possibly damaging 0.65
R5724:Sptbn1 UTSW 11 30,094,113 (GRCm39) missense possibly damaging 0.91
R5738:Sptbn1 UTSW 11 30,095,941 (GRCm39) missense probably damaging 1.00
R5864:Sptbn1 UTSW 11 30,095,925 (GRCm39) missense probably damaging 1.00
R5895:Sptbn1 UTSW 11 30,073,978 (GRCm39) missense probably damaging 0.99
R5932:Sptbn1 UTSW 11 30,086,136 (GRCm39) missense probably damaging 1.00
R5966:Sptbn1 UTSW 11 30,074,873 (GRCm39) missense probably damaging 1.00
R5984:Sptbn1 UTSW 11 30,068,464 (GRCm39) missense probably damaging 1.00
R6155:Sptbn1 UTSW 11 30,087,403 (GRCm39) missense probably damaging 0.99
R6163:Sptbn1 UTSW 11 30,109,443 (GRCm39) nonsense probably null
R6226:Sptbn1 UTSW 11 30,086,054 (GRCm39) missense probably damaging 1.00
R6271:Sptbn1 UTSW 11 30,050,660 (GRCm39) missense probably benign 0.00
R6443:Sptbn1 UTSW 11 30,089,429 (GRCm39) missense possibly damaging 0.56
R6591:Sptbn1 UTSW 11 30,063,984 (GRCm39) missense probably damaging 0.99
R6616:Sptbn1 UTSW 11 30,074,030 (GRCm39) missense probably benign 0.08
R6691:Sptbn1 UTSW 11 30,063,984 (GRCm39) missense probably damaging 0.99
R6751:Sptbn1 UTSW 11 30,067,859 (GRCm39) missense probably damaging 1.00
R6823:Sptbn1 UTSW 11 30,064,787 (GRCm39) missense probably damaging 1.00
R6863:Sptbn1 UTSW 11 30,096,777 (GRCm39) missense possibly damaging 0.94
R6885:Sptbn1 UTSW 11 30,088,634 (GRCm39) missense probably benign 0.26
R6892:Sptbn1 UTSW 11 30,092,187 (GRCm39) missense probably benign 0.27
R6998:Sptbn1 UTSW 11 30,050,633 (GRCm39) missense probably damaging 0.97
R7043:Sptbn1 UTSW 11 30,053,323 (GRCm39) missense probably benign 0.02
R7092:Sptbn1 UTSW 11 30,087,119 (GRCm39) missense possibly damaging 0.75
R7272:Sptbn1 UTSW 11 30,064,859 (GRCm39) missense possibly damaging 0.93
R7301:Sptbn1 UTSW 11 30,067,798 (GRCm39) nonsense probably null
R7379:Sptbn1 UTSW 11 30,089,292 (GRCm39) missense possibly damaging 0.72
R7774:Sptbn1 UTSW 11 30,092,142 (GRCm39) missense probably damaging 0.99
R7813:Sptbn1 UTSW 11 30,088,455 (GRCm39) missense probably damaging 1.00
R7837:Sptbn1 UTSW 11 30,088,832 (GRCm39) missense probably damaging 1.00
R7843:Sptbn1 UTSW 11 30,104,320 (GRCm39) missense probably damaging 1.00
R7846:Sptbn1 UTSW 11 30,092,153 (GRCm39) missense probably damaging 0.98
R7877:Sptbn1 UTSW 11 30,079,601 (GRCm39) missense possibly damaging 0.94
R7902:Sptbn1 UTSW 11 30,086,048 (GRCm39) missense probably damaging 1.00
R8060:Sptbn1 UTSW 11 30,051,616 (GRCm39) missense probably damaging 0.99
R8116:Sptbn1 UTSW 11 30,089,117 (GRCm39) missense probably damaging 1.00
R8169:Sptbn1 UTSW 11 30,147,783 (GRCm39) missense possibly damaging 0.62
R8208:Sptbn1 UTSW 11 30,074,972 (GRCm39) missense probably damaging 1.00
R8247:Sptbn1 UTSW 11 30,063,906 (GRCm39) missense possibly damaging 0.84
R8412:Sptbn1 UTSW 11 30,088,457 (GRCm39) missense probably damaging 1.00
R8470:Sptbn1 UTSW 11 30,070,758 (GRCm39) missense possibly damaging 0.78
R8544:Sptbn1 UTSW 11 30,169,750 (GRCm39) start gained probably benign
R8674:Sptbn1 UTSW 11 30,089,352 (GRCm39) missense possibly damaging 0.73
R8846:Sptbn1 UTSW 11 30,075,009 (GRCm39) missense possibly damaging 0.77
R8889:Sptbn1 UTSW 11 30,067,800 (GRCm39) missense probably benign 0.03
R8892:Sptbn1 UTSW 11 30,067,800 (GRCm39) missense probably benign 0.03
R8927:Sptbn1 UTSW 11 30,088,962 (GRCm39) missense probably damaging 1.00
R8928:Sptbn1 UTSW 11 30,088,962 (GRCm39) missense probably damaging 1.00
R8975:Sptbn1 UTSW 11 30,073,869 (GRCm39) missense possibly damaging 0.86
R9115:Sptbn1 UTSW 11 30,087,526 (GRCm39) missense probably damaging 1.00
R9127:Sptbn1 UTSW 11 30,104,356 (GRCm39) missense probably damaging 1.00
R9193:Sptbn1 UTSW 11 30,087,551 (GRCm39) missense possibly damaging 0.77
R9237:Sptbn1 UTSW 11 30,096,803 (GRCm39) missense probably damaging 1.00
Z1176:Sptbn1 UTSW 11 30,147,787 (GRCm39) missense probably benign 0.13
Z1176:Sptbn1 UTSW 11 30,087,439 (GRCm39) missense probably damaging 1.00
Z1177:Sptbn1 UTSW 11 30,070,659 (GRCm39) missense probably benign 0.27
Z1177:Sptbn1 UTSW 11 30,064,734 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGGCAGGGCTTCCAGACTTAC -3'
(R):5'- TCGCTCCCTTAGATGCTGGAGAATC -3'

Sequencing Primer
(F):5'- CCGGTTCTAGTGGCATTAAAATCC -3'
(R):5'- CCCTTAGATGCTGGAGAATCAGATG -3'
Posted On 2013-04-24