Incidental Mutation 'R0370:Dcc'
ID30449
Institutional Source Beutler Lab
Gene Symbol Dcc
Ensembl Gene ENSMUSG00000060534
Gene Namedeleted in colorectal carcinoma
SynonymsC030036D22Rik, Igdcc1
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location71258738-72351069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71587985 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 435 (V435A)
Ref Sequence ENSEMBL: ENSMUSP00000110593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073379] [ENSMUST00000114943]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073379
AA Change: V435A

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073094
Gene: ENSMUSG00000060534
AA Change: V435A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 824 909 2.48e-6 SMART
FN3 925 1011 1.35e-7 SMART
transmembrane domain 1079 1101 N/A INTRINSIC
Pfam:Neogenin_C 1126 1425 5.5e-129 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114943
AA Change: V435A

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110593
Gene: ENSMUSG00000060534
AA Change: V435A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 844 929 2.48e-6 SMART
FN3 945 1031 1.35e-7 SMART
transmembrane domain 1099 1121 N/A INTRINSIC
Pfam:Neogenin_C 1148 1445 3.4e-113 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous animals show defects in axonal projections and hypothalamic development affecting both visual and neruoendocrine systems. Incidence of tumors increases in mutations preventing netrin-1 binding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Dcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dcc APN 18 71384225 critical splice acceptor site probably null
IGL00781:Dcc APN 18 71809195 missense probably benign 0.25
IGL00818:Dcc APN 18 71955012 missense probably benign
IGL00895:Dcc APN 18 71810800 missense probably damaging 0.98
IGL00969:Dcc APN 18 71456883 missense probably benign 0.25
IGL01019:Dcc APN 18 71809090 missense probably benign 0.00
IGL01132:Dcc APN 18 71682174 nonsense probably null
IGL01349:Dcc APN 18 71370737 missense probably damaging 1.00
IGL01355:Dcc APN 18 71809114 missense probably benign 0.00
IGL01374:Dcc APN 18 71374553 missense probably damaging 1.00
IGL01947:Dcc APN 18 71826209 missense probably benign
IGL02470:Dcc APN 18 71955082 splice site probably benign
IGL02508:Dcc APN 18 71370702 missense probably benign 0.00
IGL02999:Dcc APN 18 71378678 missense possibly damaging 0.68
IGL03034:Dcc APN 18 71575143 nonsense probably null
IGL03118:Dcc APN 18 71420273 missense probably benign 0.00
IGL03133:Dcc APN 18 71262955 splice site probably benign
IGL03357:Dcc APN 18 71327554 missense probably damaging 1.00
Hyperrev UTSW 18 71259015 missense probably damaging 1.00
LCD18:Dcc UTSW 18 72297447 intron probably benign
P0031:Dcc UTSW 18 71384228 splice site probably benign
PIT4142001:Dcc UTSW 18 71384226 splice site probably null
R0076:Dcc UTSW 18 71321046 nonsense probably null
R0355:Dcc UTSW 18 71575208 missense possibly damaging 0.75
R0383:Dcc UTSW 18 71420263 missense probably damaging 0.99
R0541:Dcc UTSW 18 71259015 missense probably damaging 1.00
R0690:Dcc UTSW 18 71809204 splice site probably benign
R0762:Dcc UTSW 18 71342705 splice site probably benign
R0765:Dcc UTSW 18 71362990 missense probably damaging 1.00
R0846:Dcc UTSW 18 71826212 missense probably benign 0.06
R1230:Dcc UTSW 18 71682313 missense probably damaging 1.00
R1662:Dcc UTSW 18 71420338 missense probably benign 0.00
R1663:Dcc UTSW 18 71826052 missense probably damaging 1.00
R1697:Dcc UTSW 18 71370737 missense probably damaging 1.00
R1770:Dcc UTSW 18 71446399 missense probably benign 0.01
R1781:Dcc UTSW 18 71378717 missense probably benign 0.41
R1797:Dcc UTSW 18 71367161 missense probably damaging 1.00
R2101:Dcc UTSW 18 71810870 missense possibly damaging 0.62
R2190:Dcc UTSW 18 71547420 missense possibly damaging 0.89
R2248:Dcc UTSW 18 71826168 missense probably benign 0.00
R2262:Dcc UTSW 18 71374551 missense probably damaging 1.00
R2442:Dcc UTSW 18 71456883 missense probably damaging 0.98
R3844:Dcc UTSW 18 71826186 missense probably benign 0.01
R4037:Dcc UTSW 18 72350397 missense possibly damaging 0.57
R4085:Dcc UTSW 18 71826169 missense probably benign 0.00
R4344:Dcc UTSW 18 71374490 missense probably damaging 0.99
R4499:Dcc UTSW 18 71547317 missense probably benign 0.07
R4611:Dcc UTSW 18 71548998 splice site probably null
R4811:Dcc UTSW 18 71299483 missense probably benign 0.31
R4937:Dcc UTSW 18 71542249 nonsense probably null
R5125:Dcc UTSW 18 71456877 missense probably benign 0.02
R5292:Dcc UTSW 18 71306088 missense probably damaging 1.00
R5297:Dcc UTSW 18 71378738 missense probably benign 0.00
R5317:Dcc UTSW 18 71384155 missense possibly damaging 0.78
R5691:Dcc UTSW 18 71575083 missense probably damaging 1.00
R5693:Dcc UTSW 18 71575082 missense probably damaging 1.00
R6091:Dcc UTSW 18 71809114 missense probably benign 0.00
R6291:Dcc UTSW 18 71682167 missense probably benign 0.06
R6307:Dcc UTSW 18 71810755 missense probably benign 0.15
R6343:Dcc UTSW 18 71336035 missense probably damaging 1.00
R6508:Dcc UTSW 18 71306073 missense probably damaging 1.00
R6701:Dcc UTSW 18 71809120 missense probably benign 0.02
R6810:Dcc UTSW 18 71370693 missense probably damaging 0.99
R7078:Dcc UTSW 18 71547398 missense probably benign 0.05
R7172:Dcc UTSW 18 71378684 missense probably benign 0.04
W0251:Dcc UTSW 18 71826083 missense probably damaging 1.00
X0020:Dcc UTSW 18 71321100 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACAGTGTTCCAGGAAAGAAGCTCAAAT -3'
(R):5'- TGGTCATGGAATCCAGGGCTAGAAA -3'

Sequencing Primer
(F):5'- CCAGGAAAGAAGCTCAAATTTACTG -3'
(R):5'- GAATCCAGGGCTAGAAAAAAAAATCC -3'
Posted On2013-04-24