Incidental Mutation 'R0371:Sorcs3'
ID30506
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Namesortilin-related VPS10 domain containing receptor 3
Synonyms6330404A12Rik
MMRRC Submission 038577-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R0371 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location48206025-48805505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48603894 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 333 (I333V)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
Predicted Effect probably benign
Transcript: ENSMUST00000078880
AA Change: I333V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: I333V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,288,047 R1068C probably benign Het
Afmid C T 11: 117,835,140 probably benign Het
Aqr A G 2: 114,157,604 V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 T288R possibly damaging Het
Btnl1 T C 17: 34,381,057 V178A probably damaging Het
Ccdc110 T A 8: 45,942,806 M578K possibly damaging Het
Ccdc38 G T 10: 93,562,812 E51* probably null Het
Cep290 T A 10: 100,518,564 probably benign Het
Cilp2 T C 8: 69,881,606 E914G probably damaging Het
Col6a2 T C 10: 76,614,473 N208S probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp4a12a C G 4: 115,326,683 R229G probably damaging Het
Dach1 C T 14: 97,969,903 V337M probably damaging Het
Dcbld2 A G 16: 58,450,823 N321S probably benign Het
Enpep C T 3: 129,283,867 probably null Het
Fat1 T C 8: 44,951,892 L560P probably damaging Het
Fdxr T C 11: 115,276,089 H58R possibly damaging Het
Filip1 G T 9: 79,860,091 P147T probably damaging Het
Fras1 G A 5: 96,555,331 E318K possibly damaging Het
Gm4759 A T 7: 106,422,779 C339S unknown Het
Grk2 T C 19: 4,291,586 probably null Het
Havcr1 T C 11: 46,752,589 I112T possibly damaging Het
Hjurp G A 1: 88,277,368 probably benign Het
Ildr2 G A 1: 166,303,564 V330I probably damaging Het
Ino80d T C 1: 63,057,956 probably benign Het
Iqsec1 A G 6: 90,670,403 probably benign Het
Irf2bpl C T 12: 86,881,643 W752* probably null Het
Kdr T A 5: 75,941,834 H1211L probably benign Het
Klri2 A G 6: 129,732,143 *249R probably null Het
Ktn1 A T 14: 47,724,003 K1054* probably null Het
Lactb2 A G 1: 13,650,760 S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 C15* probably null Het
Mrs2 T C 13: 24,993,095 I430V probably benign Het
Myo3b C T 2: 70,252,960 probably benign Het
Nbas C T 12: 13,331,095 T696I probably damaging Het
Nsun6 T C 2: 15,030,087 D240G probably damaging Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1283 A T 2: 111,369,153 I174L probably benign Het
Olfr205 A G 16: 59,329,222 C96R possibly damaging Het
Olfr411 T A 11: 74,346,934 I217F probably damaging Het
Olfr447 A T 6: 42,911,938 R138S probably benign Het
Pabpc1l G A 2: 164,035,272 V256M probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sik1 T C 17: 31,848,984 D409G probably benign Het
Slc22a22 A T 15: 57,249,735 D369E possibly damaging Het
Smg1 T A 7: 118,168,300 probably benign Het
Snap29 C A 16: 17,406,203 D27E probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spag7 A G 11: 70,664,796 M105T probably damaging Het
Srgap3 A T 6: 112,771,471 S407T probably damaging Het
Supt6 T C 11: 78,223,157 N854S probably benign Het
Syne2 T C 12: 75,933,845 S1460P probably damaging Het
Taok3 C T 5: 117,206,687 Q160* probably null Het
Tchhl1 C A 3: 93,469,577 A27E probably damaging Het
Tet1 T C 10: 62,878,399 D539G probably damaging Het
Tut1 T C 19: 8,962,773 F374L probably damaging Het
Unc5c C T 3: 141,827,522 P770S probably benign Het
Vmn2r101 T A 17: 19,590,132 N393K probably benign Het
Vmn2r94 T A 17: 18,257,294 H285L probably benign Het
Wdr62 G A 7: 30,242,158 S700L possibly damaging Het
Wscd1 A G 11: 71,788,723 D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 N106S probably damaging Het
Zfp345 G T 2: 150,472,063 T518N possibly damaging Het
Zfp648 A T 1: 154,204,667 S191C possibly damaging Het
Zkscan8 C T 13: 21,526,674 E89K probably damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48683658 critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48748319 missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48603864 missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48767103 missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48796375 missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48790131 missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48794168 missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48535531 missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48654072 missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48704370 splice site probably benign
IGL02830:Sorcs3 APN 19 48723002 splice site probably null
IGL02943:Sorcs3 APN 19 48759938 missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48654044 missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48748319 missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48797517 critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48802698 nonsense probably null
R0646:Sorcs3 UTSW 19 48206295 missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48487406 missense probably benign
R0792:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48693994 missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48487394 missense probably benign
R1253:Sorcs3 UTSW 19 48206736 missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48694001 critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48764181 missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48748359 critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48603875 missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48794274 missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48722925 missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48398711 missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48603904 missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48722956 missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48749373 missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48693914 missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48683597 missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48794163 missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48764148 missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48759951 missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48759845 critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48796472 splice site probably null
R5848:Sorcs3 UTSW 19 48788511 missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48749396 missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48796450 missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48398697 missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48759857 missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48790166 missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48802759 missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48764307 critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48788505 missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48713571 missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48693824 missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48749343 missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48705963 missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48772266 missense possibly damaging 0.69
X0018:Sorcs3 UTSW 19 48772289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTAGGGTAAGACCTGAGTGTGAG -3'
(R):5'- CTAAGAGCACCTAGTGACAAGCCTTC -3'

Sequencing Primer
(F):5'- GGCACAATATGGTTCTTGCATC -3'
(R):5'- atcgtgttccaattccataactc -3'
Posted On2013-04-24