Incidental Mutation 'R0372:Abca2'
ID30512
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
MMRRC Submission 038578-MU
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0372 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25437353 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 641 (Y641C)
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect probably damaging
Transcript: ENSMUST00000102919
AA Change: Y641C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944
AA Change: Y641C

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150550
Meta Mutation Damage Score 0.512 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency 97% (70/72)
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T A 14: 63,973,482 Q99L probably damaging Het
Abhd10 A G 16: 45,736,891 probably null Het
Acan G T 7: 79,100,601 A1707S probably benign Het
Ankrd61 T A 5: 143,891,175 R284S probably benign Het
Ap3d1 T C 10: 80,723,567 K258E probably damaging Het
Arl6ip6 T G 2: 53,202,921 F153V probably damaging Het
Atp2c2 C A 8: 119,757,441 F930L probably benign Het
Avl9 T C 6: 56,726,324 probably null Het
Axin2 A G 11: 108,923,333 S16G probably damaging Het
Axin2 T A 11: 108,924,110 probably benign Het
Bbs7 A T 3: 36,602,832 D282E probably benign Het
Ccny A T 18: 9,345,201 V191D probably damaging Het
Cdk11b A G 4: 155,641,500 probably benign Het
Chd1 T A 17: 17,387,290 C367S probably benign Het
Cnnm4 G A 1: 36,498,010 V472M probably damaging Het
Cpb2 T A 14: 75,242,377 I8N probably benign Het
Dusp11 A G 6: 85,958,730 probably benign Het
Elmo1 T C 13: 20,572,459 probably null Het
Gbf1 C T 19: 46,285,704 P1726S probably benign Het
Hal A G 10: 93,507,553 probably benign Het
Hlcs T C 16: 94,138,907 I671V possibly damaging Het
Ifnab A G 4: 88,690,834 S132P probably benign Het
Ing5 T C 1: 93,812,420 I70T probably damaging Het
Ints1 T C 5: 139,772,438 N228S probably damaging Het
Itgb6 T A 2: 60,627,841 I523F probably benign Het
Kat2b T C 17: 53,638,537 F328S possibly damaging Het
Kbtbd3 A T 9: 4,316,950 I34F possibly damaging Het
Klhl11 A T 11: 100,463,522 I491N probably damaging Het
Lmo7 A T 14: 101,918,053 probably benign Het
Lrp1 G T 10: 127,592,136 P523T probably damaging Het
Lrp1b T A 2: 40,730,798 D3556V probably benign Het
Lrp2 T A 2: 69,535,043 H262L probably benign Het
Lrrc27 T A 7: 139,226,187 I256K probably benign Het
Lrrc47 G A 4: 154,019,632 R523K probably benign Het
Lrrc71 A T 3: 87,745,777 S111T probably benign Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Mphosph10 G T 7: 64,388,855 probably benign Het
Nlrp4a T C 7: 26,449,232 probably benign Het
Nsd2 A T 5: 33,891,551 M1140L probably damaging Het
Nt5dc3 T C 10: 86,825,291 M440T possibly damaging Het
Olfr183 T C 16: 59,000,087 V134A probably benign Het
Oog4 A T 4: 143,437,689 L424Q probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Papola T C 12: 105,818,838 F410L probably benign Het
Pcdh10 A G 3: 45,379,497 E82G probably damaging Het
Pcdh20 T C 14: 88,469,003 Y287C probably damaging Het
Pld1 T A 3: 28,088,638 probably null Het
Plekha8 G A 6: 54,616,758 probably null Het
Ppbp C T 5: 90,769,343 T93M possibly damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rab3gap2 C T 1: 185,262,694 T810M possibly damaging Het
Rassf9 A G 10: 102,546,011 N418S possibly damaging Het
Rnf20 C G 4: 49,650,176 R582G possibly damaging Het
Serpine2 T C 1: 79,821,430 I36V probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc24a2 A T 4: 87,227,292 V175E probably damaging Het
Sned1 T C 1: 93,285,951 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 GCC G 2: 122,059,447 probably null Het
Tecrl C T 5: 83,294,659 C189Y probably damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Thnsl2 T C 6: 71,139,790 Y126C probably damaging Het
Tll2 T C 19: 41,183,313 probably null Het
Ubqln4 C T 3: 88,555,969 S147L probably benign Het
Ugt2b5 A T 5: 87,140,258 C17S probably benign Het
Vps41 A T 13: 18,842,247 Q505L probably benign Het
Zfp386 T C 12: 116,054,816 M35T possibly damaging Het
Zfp777 T C 6: 48,044,476 M71V possibly damaging Het
Zfp938 A T 10: 82,227,828 L34Q probably damaging Het
Zfp974 A T 7: 27,920,695 probably null Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
Abseiling UTSW 2 25447003 missense possibly damaging 0.65
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1448:Abca2 UTSW 2 25440530 missense possibly damaging 0.73
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1545:Abca2 UTSW 2 25442358 missense probably benign 0.17
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1586:Abca2 UTSW 2 25447216 missense probably damaging 0.98
R1635:Abca2 UTSW 2 25444856 missense probably benign 0.03
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1754:Abca2 UTSW 2 25434333 missense probably benign 0.01
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2248:Abca2 UTSW 2 25433464 splice site probably benign
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5840:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6344:Abca2 UTSW 2 25437694 missense probably damaging 1.00
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6980:Abca2 UTSW 2 25440866 missense possibly damaging 0.89
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
R7070:Abca2 UTSW 2 25442995 missense probably benign 0.06
R7080:Abca2 UTSW 2 25446104 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGCTTCAGTTTGCTCCCACAGG -3'
(R):5'- CCATGCACAATGGCATCATGTGTTC -3'

Sequencing Primer
(F):5'- AGTGCTCACCTCACTGTGTC -3'
(R):5'- GAACATCTGCACGTAGTTGCC -3'
Protein Function and Prediction

Abca2 encodes ABCA2, a member of the A subfamily of ATP-binding cassette (ABC) transporters that function to translocate molecules across cellular membranes. ABCA2 functions in trafficking low-density lipoprotein (LDL)-derived free cholesterol (1). The ABCA2 protein has two transmembrane domains and two ABCs, the ABC consensus sequence is comprised of Walker A and Walker B motifs separated by 90-120 amino acids (2). Reverse transcriptase-PCR ELISA detected ABCA2 in all human adult and fetal tissues examined (lung, kidney, heart, liver, ovary, skeletal muscle, brain, pancreas, testis, spleen and liver); highest expression was in the brain and spinal cord (3). Additional studies determined that ABCA2 is most abundant in the central nervous system, ovary, and macrophages (4). ABCA2 colocalizes with the lysosomal/endosomal marker LAMP1 (4). ABCA2 expression has been linked with gene cluster patterns consistent with Alzheimer’s disease.

 

Abca2tm1Kdt/tm1Kdt; MGI: 3697467

involves: 129/Sv

Homozygotes exhibit decreased body weight compared to controls as well as increased fear-related responses, increased startle reflex to sound, tremors, impaired ability to counterbalance, hyperactivity, and increased rearing and climbing behavior (5). Homozygotes also have abnormal myeline sheath morphology: average myelin sheath thickness in the spinal cord is increased and there is reduced periodicity and compaction of myelin (5).

 

Abca2tm1Nina/tm1Nina; MGI: 3719855

involves: 129X1/SvJ * C57BL/6

Homozygotes exhibit increased morbidity/mortality when moved onto wet sawdust, tremors, impaired balance, abnormal sphingomyelin in their brain after growth stage, and increased levels of ganglioside GM1, cerebrosides and silfatide levels (6). In addition, homozygotes have decreased body weight (6). Female homozygotes have reduced female fertility (6).

References
Posted On2013-04-24
Science WriterAnne Murray