Incidental Mutation 'R0372:Pld1'
ID30516
Institutional Source Beutler Lab
Gene Symbol Pld1
Ensembl Gene ENSMUSG00000027695
Gene Namephospholipase D1
SynonymsPld1a, Pld1b
MMRRC Submission 038578-MU
Accession Numbers

Genbank: NM_001164056; MGI: 109585

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0372 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location27938695-28133362 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 28088638 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000067757] [ENSMUST00000067757] [ENSMUST00000067757] [ENSMUST00000067757] [ENSMUST00000120834] [ENSMUST00000120834] [ENSMUST00000120834] [ENSMUST00000123539] [ENSMUST00000123539] [ENSMUST00000123539] [ENSMUST00000123539] [ENSMUST00000123539]
Predicted Effect probably null
Transcript: ENSMUST00000067757
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067757
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067757
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067757
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120834
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120834
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120834
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123539
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123539
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123539
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123539
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123539
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131842
Predicted Effect probably null
Transcript: ENSMUST00000148827
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148827
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148827
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148827
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148827
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Meta Mutation Damage Score 0.6444 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylcholine-specific phospholipase which catalyzes the hydrolysis of phosphatidylcholine in order to yield phosphatidic acid and choline. The enzyme may play a role in signal transduction and subcellular trafficking. Alternative splicing results in multiple transcript variants with both catalytic and regulatory properties. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a null allele show reduced tumor growth and angiogenesis. Homozygotes for a second null allele show abnormal hepatic autophagy after food restriction. Homozygotes for a third null allele show altered platelet activation and protection from thrombosis and ischemic brain injury. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T A 14: 63,973,482 Q99L probably damaging Het
Abca2 A G 2: 25,437,353 Y641C probably damaging Het
Abhd10 A G 16: 45,736,891 probably null Het
Acan G T 7: 79,100,601 A1707S probably benign Het
Ankrd61 T A 5: 143,891,175 R284S probably benign Het
Ap3d1 T C 10: 80,723,567 K258E probably damaging Het
Arl6ip6 T G 2: 53,202,921 F153V probably damaging Het
Atp2c2 C A 8: 119,757,441 F930L probably benign Het
Avl9 T C 6: 56,726,324 probably null Het
Axin2 A G 11: 108,923,333 S16G probably damaging Het
Axin2 T A 11: 108,924,110 probably benign Het
Bbs7 A T 3: 36,602,832 D282E probably benign Het
Ccny A T 18: 9,345,201 V191D probably damaging Het
Cdk11b A G 4: 155,641,500 probably benign Het
Chd1 T A 17: 17,387,290 C367S probably benign Het
Cnnm4 G A 1: 36,498,010 V472M probably damaging Het
Cpb2 T A 14: 75,242,377 I8N probably benign Het
Dusp11 A G 6: 85,958,730 probably benign Het
Elmo1 T C 13: 20,572,459 probably null Het
Gbf1 C T 19: 46,285,704 P1726S probably benign Het
Hal A G 10: 93,507,553 probably benign Het
Hlcs T C 16: 94,138,907 I671V possibly damaging Het
Ifnab A G 4: 88,690,834 S132P probably benign Het
Ing5 T C 1: 93,812,420 I70T probably damaging Het
Ints1 T C 5: 139,772,438 N228S probably damaging Het
Itgb6 T A 2: 60,627,841 I523F probably benign Het
Kat2b T C 17: 53,638,537 F328S possibly damaging Het
Kbtbd3 A T 9: 4,316,950 I34F possibly damaging Het
Klhl11 A T 11: 100,463,522 I491N probably damaging Het
Lmo7 A T 14: 101,918,053 probably benign Het
Lrp1 G T 10: 127,592,136 P523T probably damaging Het
Lrp1b T A 2: 40,730,798 D3556V probably benign Het
Lrp2 T A 2: 69,535,043 H262L probably benign Het
Lrrc27 T A 7: 139,226,187 I256K probably benign Het
Lrrc47 G A 4: 154,019,632 R523K probably benign Het
Lrrc71 A T 3: 87,745,777 S111T probably benign Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Mphosph10 G T 7: 64,388,855 probably benign Het
Nlrp4a T C 7: 26,449,232 probably benign Het
Nsd2 A T 5: 33,891,551 M1140L probably damaging Het
Nt5dc3 T C 10: 86,825,291 M440T possibly damaging Het
Olfr183 T C 16: 59,000,087 V134A probably benign Het
Oog4 A T 4: 143,437,689 L424Q probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Papola T C 12: 105,818,838 F410L probably benign Het
Pcdh10 A G 3: 45,379,497 E82G probably damaging Het
Pcdh20 T C 14: 88,469,003 Y287C probably damaging Het
Plekha8 G A 6: 54,616,758 probably null Het
Ppbp C T 5: 90,769,343 T93M possibly damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rab3gap2 C T 1: 185,262,694 T810M possibly damaging Het
Rassf9 A G 10: 102,546,011 N418S possibly damaging Het
Rnf20 C G 4: 49,650,176 R582G possibly damaging Het
Serpine2 T C 1: 79,821,430 I36V probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc24a2 A T 4: 87,227,292 V175E probably damaging Het
Sned1 T C 1: 93,285,951 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 GCC G 2: 122,059,447 probably null Het
Tecrl C T 5: 83,294,659 C189Y probably damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Thnsl2 T C 6: 71,139,790 Y126C probably damaging Het
Tll2 T C 19: 41,183,313 probably null Het
Ubqln4 C T 3: 88,555,969 S147L probably benign Het
Ugt2b5 A T 5: 87,140,258 C17S probably benign Het
Vps41 A T 13: 18,842,247 Q505L probably benign Het
Zfp386 T C 12: 116,054,816 M35T possibly damaging Het
Zfp777 T C 6: 48,044,476 M71V possibly damaging Het
Zfp938 A T 10: 82,227,828 L34Q probably damaging Het
Zfp974 A T 7: 27,920,695 probably null Het
Other mutations in Pld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Pld1 APN 3 28045098 critical splice donor site probably null
IGL01090:Pld1 APN 3 28088667 missense probably benign 0.01
IGL01140:Pld1 APN 3 28078237 missense probably benign 0.01
IGL01646:Pld1 APN 3 28099664 missense probably damaging 1.00
IGL01830:Pld1 APN 3 28048004 splice site probably benign
IGL01946:Pld1 APN 3 28124617 missense probably damaging 1.00
IGL02139:Pld1 APN 3 28120812 missense probably damaging 0.98
IGL02189:Pld1 APN 3 28120783 missense probably benign 0.03
IGL02476:Pld1 APN 3 28048039 missense probably damaging 1.00
IGL02540:Pld1 APN 3 28029160 unclassified probably benign
IGL02649:Pld1 APN 3 28087229 missense probably damaging 0.98
IGL02720:Pld1 APN 3 28087262 missense probably damaging 1.00
IGL02831:Pld1 APN 3 28076425 missense probably damaging 0.99
IGL02953:Pld1 APN 3 28112247 missense probably benign 0.03
IGL03005:Pld1 APN 3 28087253 missense possibly damaging 0.78
IGL03251:Pld1 APN 3 28088665 missense probably benign 0.06
IGL03331:Pld1 APN 3 28085845 missense probably damaging 1.00
A9681:Pld1 UTSW 3 28085832 missense probably benign 0.01
IGL03134:Pld1 UTSW 3 28029167 missense probably benign 0.01
P0023:Pld1 UTSW 3 28048125 missense probably damaging 1.00
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0282:Pld1 UTSW 3 28078273 missense probably benign
R0454:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R0492:Pld1 UTSW 3 28109817 missense probably damaging 0.96
R0505:Pld1 UTSW 3 28120822 missense possibly damaging 0.69
R0667:Pld1 UTSW 3 28079178 splice site probably null
R0678:Pld1 UTSW 3 28120784 missense probably damaging 0.99
R0980:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R1200:Pld1 UTSW 3 28049286 missense probably damaging 1.00
R1235:Pld1 UTSW 3 28028734 missense probably benign 0.05
R1657:Pld1 UTSW 3 28071187 missense probably benign 0.04
R1670:Pld1 UTSW 3 28049240 missense probably benign 0.17
R1705:Pld1 UTSW 3 28071277 critical splice donor site probably null
R1815:Pld1 UTSW 3 28109768 missense probably benign 0.04
R2215:Pld1 UTSW 3 28078393 missense probably benign 0.16
R3435:Pld1 UTSW 3 28124623 missense probably benign 0.13
R3522:Pld1 UTSW 3 28031247 missense probably damaging 1.00
R4206:Pld1 UTSW 3 28120783 missense probably benign 0.03
R4553:Pld1 UTSW 3 28124702 missense probably benign
R4612:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R4623:Pld1 UTSW 3 28029244 missense probably benign 0.01
R4840:Pld1 UTSW 3 28076551 missense probably benign 0.10
R4869:Pld1 UTSW 3 28109802 missense possibly damaging 0.84
R4982:Pld1 UTSW 3 28031298 missense probably damaging 0.97
R5087:Pld1 UTSW 3 28124582 missense probably damaging 1.00
R5182:Pld1 UTSW 3 28045081 missense probably damaging 1.00
R5384:Pld1 UTSW 3 28025320 missense probably damaging 1.00
R6243:Pld1 UTSW 3 28095805 missense probably damaging 0.98
R6345:Pld1 UTSW 3 28130747 intron probably benign
R6692:Pld1 UTSW 3 28041199 missense probably benign 0.15
R6881:Pld1 UTSW 3 28078414 missense possibly damaging 0.77
R7197:Pld1 UTSW 3 28024252 missense probably damaging 1.00
R7267:Pld1 UTSW 3 28076401 missense probably damaging 1.00
R7284:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R7293:Pld1 UTSW 3 28087286 missense probably damaging 0.99
R7440:Pld1 UTSW 3 28041270 missense probably benign 0.01
R7524:Pld1 UTSW 3 28024321 missense not run
Z1088:Pld1 UTSW 3 28029243 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGAGTGGATAAATGAACACAGCAC -3'
(R):5'- CACACAGGGGTTCAAGAACTACGAG -3'

Sequencing Primer
(F):5'- gggccagattcagggtg -3'
(R):5'- CGAGAAAATGCTTTTGGGTAAACC -3'
Posted On2013-04-24