Incidental Mutation 'R0375:Frmpd1'
ID30679
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45284196 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1006 (T1006A)
Ref Sequence ENSEMBL: ENSMUSP00000103434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect probably benign
Transcript: ENSMUST00000044773
AA Change: T1006A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: T1006A

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107804
AA Change: T1006A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: T1006A

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K probably damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45283993 missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45268497 missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45284093 missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45284382 missense probably benign
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45284915 missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45284850 missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCCATTCGCCTCCGAATTGAC -3'
(R):5'- TTCACTTCACATTCACCGCTGGTAG -3'

Sequencing Primer
(F):5'- GCCTCCGAATTGACCCCAG -3'
(R):5'- TAGGCCCATCTCCAGGAC -3'
Posted On2013-04-24