Incidental Mutation 'R3934:Mcm2'
ID 306935
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Name minichromosome maintenance complex component 2
Synonyms BM28, CDCL1, Mcmd2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3934 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 88860456-88875762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88869990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 60 (R60C)
Ref Sequence ENSEMBL: ENSMUSP00000145295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
AlphaFold P97310
Predicted Effect possibly damaging
Transcript: ENSMUST00000058011
AA Change: R204C

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: R204C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203172
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204393
Predicted Effect probably damaging
Transcript: ENSMUST00000205165
AA Change: R60C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870
AA Change: R60C

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Meta Mutation Damage Score 0.1633 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,584,082 (GRCm39) Y381N possibly damaging Het
Adgrf3 T C 5: 30,405,432 (GRCm39) probably benign Het
Adgrv1 A G 13: 81,623,166 (GRCm39) F3819S probably benign Het
Aig1 T C 10: 13,677,656 (GRCm39) D112G probably damaging Het
Akap6 C T 12: 53,187,227 (GRCm39) T1547M possibly damaging Het
Alk T A 17: 72,512,949 (GRCm39) I337F probably damaging Het
C2cd5 C T 6: 142,987,106 (GRCm39) V499I possibly damaging Het
Capn11 A T 17: 45,945,213 (GRCm39) probably benign Het
Clstn3 G A 6: 124,434,901 (GRCm39) T338I probably damaging Het
Cmbl A G 15: 31,589,933 (GRCm39) D221G possibly damaging Het
Enpp2 A G 15: 54,709,317 (GRCm39) V766A probably benign Het
Fastk G T 5: 24,647,257 (GRCm39) S317* probably null Het
Fgfr1op2 T A 6: 146,496,669 (GRCm39) probably benign Het
Gpr85 A G 6: 13,836,044 (GRCm39) F287L probably benign Het
Hectd4 G A 5: 121,458,164 (GRCm39) probably null Het
Hmcn2 T A 2: 31,270,496 (GRCm39) probably null Het
Hspbp1 A T 7: 4,667,594 (GRCm39) M271K probably benign Het
Itgb6 G A 2: 60,441,755 (GRCm39) T685M possibly damaging Het
Itih5 G A 2: 10,250,355 (GRCm39) V685I probably damaging Het
Kalrn T C 16: 34,130,901 (GRCm39) S421G probably benign Het
Mitf C T 6: 97,970,214 (GRCm39) P54S probably damaging Het
Perm1 A G 4: 156,303,627 (GRCm39) T724A probably benign Het
Pex5l T C 3: 33,061,321 (GRCm39) E176G probably damaging Het
Polk A T 13: 96,638,143 (GRCm39) M192K possibly damaging Het
Polr3a T C 14: 24,526,169 (GRCm39) I401V probably benign Het
Prpf38b T C 3: 108,811,741 (GRCm39) probably benign Het
Sema3c T C 5: 17,886,938 (GRCm39) S330P probably damaging Het
Slc16a7 C A 10: 125,066,712 (GRCm39) R309L probably damaging Het
Slc35f1 C T 10: 52,984,314 (GRCm39) T358I probably damaging Het
Slc39a12 T A 2: 14,439,174 (GRCm39) probably benign Het
Sod3 T C 5: 52,525,987 (GRCm39) S229P probably benign Het
Sorcs3 T A 19: 48,701,943 (GRCm39) V608D probably damaging Het
Spink5 G T 18: 44,149,494 (GRCm39) K958N probably damaging Het
Ttc7 A C 17: 87,678,166 (GRCm39) probably benign Het
Ush2a T A 1: 187,995,708 (GRCm39) probably null Het
Vmn2r19 T A 6: 123,292,628 (GRCm39) D223E probably damaging Het
Vwf T A 6: 125,532,462 (GRCm39) S87T probably damaging Het
Wdr35 G T 12: 9,058,014 (GRCm39) G513C probably damaging Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88,870,383 (GRCm39) missense probably benign 0.04
IGL01082:Mcm2 APN 6 88,864,859 (GRCm39) missense probably benign 0.05
IGL01451:Mcm2 APN 6 88,868,948 (GRCm39) splice site probably benign
IGL01534:Mcm2 APN 6 88,864,700 (GRCm39) critical splice donor site probably null
IGL01670:Mcm2 APN 6 88,864,614 (GRCm39) unclassified probably benign
IGL01724:Mcm2 APN 6 88,863,044 (GRCm39) missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88,868,708 (GRCm39) missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88,865,218 (GRCm39) nonsense probably null
dander UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
spores UTSW 6 88,874,432 (GRCm39) missense probably benign
R0254:Mcm2 UTSW 6 88,860,998 (GRCm39) missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88,869,060 (GRCm39) missense probably benign 0.12
R1740:Mcm2 UTSW 6 88,861,026 (GRCm39) missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88,866,770 (GRCm39) missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88,868,785 (GRCm39) missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88,865,234 (GRCm39) missense probably damaging 0.98
R3936:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88,868,973 (GRCm39) missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88,874,432 (GRCm39) missense probably benign
R5701:Mcm2 UTSW 6 88,870,073 (GRCm39) missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88,861,053 (GRCm39) missense probably benign 0.05
R6118:Mcm2 UTSW 6 88,864,818 (GRCm39) missense probably damaging 1.00
R6152:Mcm2 UTSW 6 88,866,891 (GRCm39) critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88,862,844 (GRCm39) missense probably benign 0.00
R6550:Mcm2 UTSW 6 88,863,941 (GRCm39) critical splice donor site probably null
R7184:Mcm2 UTSW 6 88,868,776 (GRCm39) missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88,864,928 (GRCm39) missense probably damaging 1.00
R8069:Mcm2 UTSW 6 88,869,039 (GRCm39) missense probably damaging 1.00
R8215:Mcm2 UTSW 6 88,874,293 (GRCm39) missense probably damaging 0.98
R9121:Mcm2 UTSW 6 88,861,019 (GRCm39) missense probably benign
R9745:Mcm2 UTSW 6 88,868,729 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGAGTTCAGTGCGGCAC -3'
(R):5'- TTGCTACCCAAGACAGCAG -3'

Sequencing Primer
(F):5'- GCCAGCAGGATACAGAAGCC -3'
(R):5'- TACCCAAGACAGCAGCGAGG -3'
Posted On 2015-04-17