Incidental Mutation 'R3923:Ube2l6'
ID307012
Institutional Source Beutler Lab
Gene Symbol Ube2l6
Ensembl Gene ENSMUSG00000027078
Gene Nameubiquitin-conjugating enzyme E2L 6
Synonyms2810489I21Rik, UBCH8, Ubce8, Ubcm8, RIG-B
MMRRC Submission 040820-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R3923 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84798828-84810335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84809074 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 127 (D127G)
Ref Sequence ENSEMBL: ENSMUSP00000099702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028471] [ENSMUST00000102642] [ENSMUST00000150325]
Predicted Effect probably benign
Transcript: ENSMUST00000028471
SMART Domains Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077

DomainStartEndE-ValueType
low complexity region 56 72 N/A INTRINSIC
coiled coil region 124 154 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 260 285 N/A INTRINSIC
CH 345 444 5.55e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102642
AA Change: D127G

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099702
Gene: ENSMUSG00000027078
AA Change: D127G

DomainStartEndE-ValueType
UBCc 5 149 1.03e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150325
SMART Domains Protein: ENSMUSP00000119507
Gene: ENSMUSG00000027078

DomainStartEndE-ValueType
PDB:2KJH|A 1 88 6e-18 PDB
SCOP:d1c4zd_ 3 40 7e-7 SMART
Blast:UBCc 4 89 4e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159150
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is highly similar in primary structure to the enzyme encoded by the UBE2L3 gene. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,130,514 M528V possibly damaging Het
Ano3 T A 2: 110,770,959 Y318F probably damaging Het
Asic4 T A 1: 75,451,227 D132E probably damaging Het
Atp2b2 A G 6: 113,797,108 probably null Het
Cast T C 13: 74,728,413 E447G probably damaging Het
Ccdc110 T C 8: 45,942,389 I439T probably damaging Het
Ccdc129 T C 6: 55,968,060 S589P probably benign Het
Ccdc50 A T 16: 27,444,544 R264S probably damaging Het
Chd9 T A 8: 90,933,519 V369E probably benign Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Col4a1 T A 8: 11,201,665 probably benign Het
Crtac1 A G 19: 42,333,947 V118A probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Ehmt1 A T 2: 24,884,335 probably null Het
Emc1 T A 4: 139,363,185 L412* probably null Het
Ep400 T C 5: 110,756,523 N70S possibly damaging Het
Ercc6l2 T C 13: 63,870,735 probably benign Het
Fam69c A T 18: 84,730,687 T137S probably damaging Het
Fry T C 5: 150,413,349 V1395A probably benign Het
Gm281 T A 14: 13,865,990 K300* probably null Het
Gps1 A G 11: 120,786,433 N186S possibly damaging Het
Hdgf T A 3: 87,914,228 D128E probably benign Het
Hipk3 A G 2: 104,470,762 S362P probably damaging Het
Hypk C A 2: 121,458,202 H116Q possibly damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kdm5a T C 6: 120,381,664 S223P probably benign Het
Kif21a C T 15: 90,937,294 S1432N possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lrrn2 A G 1: 132,938,492 S432G probably benign Het
Mlana T A 19: 29,704,698 S50R probably damaging Het
Mycbp2 A T 14: 103,126,713 H4383Q probably damaging Het
Ncor1 A G 11: 62,325,616 S1469P probably damaging Het
Nol6 G T 4: 41,121,531 F270L probably benign Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Nrap T C 19: 56,380,256 I243V probably damaging Het
Obscn T C 11: 59,060,928 I4297V possibly damaging Het
Olfr1056 T C 2: 86,355,861 I174V probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Palb2 A T 7: 122,117,360 probably null Het
Plod1 T C 4: 147,915,823 K260E possibly damaging Het
Rgsl1 T C 1: 153,804,130 probably null Het
Rpe65 T A 3: 159,604,400 F103L probably benign Het
Ryr3 C T 2: 112,841,873 A1438T possibly damaging Het
Slc17a3 G A 13: 23,858,054 V402M possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snph C T 2: 151,593,511 C430Y probably damaging Het
Tarbp1 T C 8: 126,440,771 I1101V probably benign Het
Tatdn1 G A 15: 58,921,171 L120F possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Trpv5 T C 6: 41,653,249 T636A probably benign Het
Usp33 T A 3: 152,374,791 probably null Het
Usp53 A T 3: 122,934,305 F876Y probably benign Het
Utrn A T 10: 12,739,479 I316K probably benign Het
Zfp106 G T 2: 120,534,856 Q357K probably damaging Het
Zfp143 T C 7: 110,074,191 V138A probably damaging Het
Zfp451 T C 1: 33,779,045 R118G probably null Het
Other mutations in Ube2l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ube2l6 APN 2 84809038 missense possibly damaging 0.79
IGL00592:Ube2l6 APN 2 84809029 missense probably damaging 1.00
IGL02000:Ube2l6 APN 2 84809162 unclassified probably benign
IGL02931:Ube2l6 APN 2 84802851 missense probably damaging 0.99
R0129:Ube2l6 UTSW 2 84798908 start codon destroyed probably null 0.17
R0277:Ube2l6 UTSW 2 84806427 unclassified probably null
R1612:Ube2l6 UTSW 2 84806373 missense probably damaging 1.00
R5137:Ube2l6 UTSW 2 84802876 critical splice donor site probably null
R6660:Ube2l6 UTSW 2 84806508 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTCACCCGTCAAGAATGAG -3'
(R):5'- TTAGGCACAGGGTGAGCTTC -3'

Sequencing Primer
(F):5'- AGCCATCCTAAGTGATGGTATGCTC -3'
(R):5'- ACAGGGTGAGCTTCCCAAG -3'
Posted On2015-04-17