Incidental Mutation 'R3923:Gps1'
ID307051
Institutional Source Beutler Lab
Gene Symbol Gps1
Ensembl Gene ENSMUSG00000025156
Gene NameG protein pathway suppressor 1
SynonymsCsn1, COPS1
MMRRC Submission 040820-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R3923 (G1)
Quality Score210
Status Not validated
Chromosome11
Chromosomal Location120784272-120789102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120786433 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 186 (N186S)
Ref Sequence ENSEMBL: ENSMUSP00000133855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026151] [ENSMUST00000026156] [ENSMUST00000100134] [ENSMUST00000106133] [ENSMUST00000106135] [ENSMUST00000116305] [ENSMUST00000153678] [ENSMUST00000167023] [ENSMUST00000172809] [ENSMUST00000208737]
Predicted Effect probably benign
Transcript: ENSMUST00000026151
SMART Domains Protein: ENSMUSP00000026151
Gene: ENSMUSG00000025155

DomainStartEndE-ValueType
Pfam:Dus 20 314 5.5e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026156
SMART Domains Protein: ENSMUSP00000026156
Gene: ENSMUSG00000025158

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 54 306 1.1e-116 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100134
AA Change: N147S

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097711
Gene: ENSMUSG00000025156
AA Change: N147S

DomainStartEndE-ValueType
Pfam:RPN7 123 305 4.9e-78 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106133
SMART Domains Protein: ENSMUSP00000101739
Gene: ENSMUSG00000025155

DomainStartEndE-ValueType
Pfam:Dus 20 314 8.5e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106135
SMART Domains Protein: ENSMUSP00000101741
Gene: ENSMUSG00000025155

DomainStartEndE-ValueType
Pfam:Dus 20 314 8.5e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000116305
AA Change: N147S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112007
Gene: ENSMUSG00000025156
AA Change: N147S

DomainStartEndE-ValueType
Pfam:RPN7 123 305 1.3e-77 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146008
Predicted Effect probably benign
Transcript: ENSMUST00000153678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156723
Predicted Effect probably benign
Transcript: ENSMUST00000167023
SMART Domains Protein: ENSMUSP00000132516
Gene: ENSMUSG00000025155

DomainStartEndE-ValueType
Pfam:Dus 20 322 1.6e-75 PFAM
low complexity region 360 371 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172809
AA Change: N186S

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133855
Gene: ENSMUSG00000025156
AA Change: N186S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:RPN7 162 344 8.8e-77 PFAM
PINT 395 478 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208737
AA Change: N147S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is known to suppress G-protein and mitogen-activated signal transduction in mammalian cells. The encoded protein shares significant similarity with Arabidopsis FUS6, which is a regulator of light-mediated signal transduction in plant cells. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,130,514 M528V possibly damaging Het
Ano3 T A 2: 110,770,959 Y318F probably damaging Het
Asic4 T A 1: 75,451,227 D132E probably damaging Het
Atp2b2 A G 6: 113,797,108 probably null Het
Cast T C 13: 74,728,413 E447G probably damaging Het
Ccdc110 T C 8: 45,942,389 I439T probably damaging Het
Ccdc129 T C 6: 55,968,060 S589P probably benign Het
Ccdc50 A T 16: 27,444,544 R264S probably damaging Het
Chd9 T A 8: 90,933,519 V369E probably benign Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Col4a1 T A 8: 11,201,665 probably benign Het
Crtac1 A G 19: 42,333,947 V118A probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Ehmt1 A T 2: 24,884,335 probably null Het
Emc1 T A 4: 139,363,185 L412* probably null Het
Ep400 T C 5: 110,756,523 N70S possibly damaging Het
Ercc6l2 T C 13: 63,870,735 probably benign Het
Fam69c A T 18: 84,730,687 T137S probably damaging Het
Fry T C 5: 150,413,349 V1395A probably benign Het
Gm281 T A 14: 13,865,990 K300* probably null Het
Hdgf T A 3: 87,914,228 D128E probably benign Het
Hipk3 A G 2: 104,470,762 S362P probably damaging Het
Hypk C A 2: 121,458,202 H116Q possibly damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kdm5a T C 6: 120,381,664 S223P probably benign Het
Kif21a C T 15: 90,937,294 S1432N possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lrrn2 A G 1: 132,938,492 S432G probably benign Het
Mlana T A 19: 29,704,698 S50R probably damaging Het
Mycbp2 A T 14: 103,126,713 H4383Q probably damaging Het
Ncor1 A G 11: 62,325,616 S1469P probably damaging Het
Nol6 G T 4: 41,121,531 F270L probably benign Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Nrap T C 19: 56,380,256 I243V probably damaging Het
Obscn T C 11: 59,060,928 I4297V possibly damaging Het
Olfr1056 T C 2: 86,355,861 I174V probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Palb2 A T 7: 122,117,360 probably null Het
Plod1 T C 4: 147,915,823 K260E possibly damaging Het
Rgsl1 T C 1: 153,804,130 probably null Het
Rpe65 T A 3: 159,604,400 F103L probably benign Het
Ryr3 C T 2: 112,841,873 A1438T possibly damaging Het
Slc17a3 G A 13: 23,858,054 V402M possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snph C T 2: 151,593,511 C430Y probably damaging Het
Tarbp1 T C 8: 126,440,771 I1101V probably benign Het
Tatdn1 G A 15: 58,921,171 L120F possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Trpv5 T C 6: 41,653,249 T636A probably benign Het
Ube2l6 A G 2: 84,809,074 D127G possibly damaging Het
Usp33 T A 3: 152,374,791 probably null Het
Usp53 A T 3: 122,934,305 F876Y probably benign Het
Utrn A T 10: 12,739,479 I316K probably benign Het
Zfp106 G T 2: 120,534,856 Q357K probably damaging Het
Zfp143 T C 7: 110,074,191 V138A probably damaging Het
Zfp451 T C 1: 33,779,045 R118G probably null Het
Other mutations in Gps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Gps1 APN 11 120788260 missense probably benign 0.44
IGL02803:Gps1 APN 11 120786823 missense probably damaging 1.00
R1977:Gps1 UTSW 11 120785826 missense probably damaging 0.98
R2366:Gps1 UTSW 11 120788119 missense probably damaging 1.00
R4631:Gps1 UTSW 11 120788239 splice site probably null
R5701:Gps1 UTSW 11 120785182 missense probably benign 0.41
R6415:Gps1 UTSW 11 120787722 missense possibly damaging 0.56
R6824:Gps1 UTSW 11 120787428 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCCTGAGAATCAGCCTGTCTG -3'
(R):5'- TGATGACATGCTTAGCACTGG -3'

Sequencing Primer
(F):5'- GATGGCTAGCTCACCCTTCAG -3'
(R):5'- AGTCTCGGGCTCGTGAGTAAC -3'
Posted On2015-04-17