Incidental Mutation 'R3924:Rsbn1l'
ID307081
Institutional Source Beutler Lab
Gene Symbol Rsbn1l
Ensembl Gene ENSMUSG00000039968
Gene Nameround spermatid basic protein 1-like
SynonymsC330002G24Rik, 8430412F05Rik
MMRRC Submission 040915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R3924 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location20893028-20956398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20919787 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 339 (V339A)
Ref Sequence ENSEMBL: ENSMUSP00000039482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036489] [ENSMUST00000196780] [ENSMUST00000197089]
Predicted Effect probably damaging
Transcript: ENSMUST00000036489
AA Change: V339A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039482
Gene: ENSMUSG00000039968
AA Change: V339A

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 71 109 N/A INTRINSIC
low complexity region 136 156 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196780
AA Change: V339A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142789
Gene: ENSMUSG00000039968
AA Change: V339A

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 71 109 N/A INTRINSIC
low complexity region 136 156 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197089
SMART Domains Protein: ENSMUSP00000142461
Gene: ENSMUSG00000039968

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197493
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,432,405 V119F probably benign Het
Agtpbp1 A T 13: 59,500,407 V533D probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Aldh3b3 A G 19: 3,968,491 N402S probably damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
Arpin A G 7: 79,929,687 Y63H probably benign Het
Brinp2 A G 1: 158,246,208 L781P probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Csad T C 15: 102,178,556 S427G probably benign Het
Dach1 A G 14: 97,915,903 V443A probably damaging Het
Dlat A G 9: 50,658,190 S160P possibly damaging Het
Dpf1 A G 7: 29,311,673 R165G possibly damaging Het
Dtd2 G C 12: 52,004,951 probably null Het
Fa2h A G 8: 111,393,515 Y80H probably damaging Het
Flii A G 11: 60,720,076 F509S probably damaging Het
Fmo9 A G 1: 166,664,652 S350P probably benign Het
Gabra4 A G 5: 71,642,253 probably benign Het
Gm3604 A G 13: 62,370,230 S105P probably damaging Het
Gpr155 T A 2: 73,370,076 L362F probably damaging Het
Lmbrd2 T C 15: 9,149,537 V86A probably benign Het
Lpcat4 G T 2: 112,246,716 Q468H possibly damaging Het
Luzp1 T C 4: 136,542,857 I797T probably damaging Het
Myh8 A T 11: 67,297,137 I912F probably damaging Het
Notch2 G T 3: 98,122,034 G1038* probably null Het
Nptx1 G T 11: 119,547,507 T28N possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Plekha5 A G 6: 140,570,379 N317S possibly damaging Het
Polr1a A G 6: 71,929,450 M417V probably benign Het
Ptpn13 T C 5: 103,550,741 probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rasd2 A G 8: 75,221,974 N176S probably damaging Het
Ryr3 A G 2: 113,028,703 probably benign Het
Shkbp1 A G 7: 27,342,402 W676R probably benign Het
Sipa1 G A 19: 5,660,379 T201I probably benign Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Zfp946 G T 17: 22,455,701 G479C probably benign Het
Other mutations in Rsbn1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Rsbn1l APN 5 20896155 missense probably benign 0.08
IGL01631:Rsbn1l APN 5 20896571 missense probably damaging 1.00
IGL01631:Rsbn1l APN 5 20896572 missense probably damaging 1.00
IGL02237:Rsbn1l APN 5 20919606 missense probably benign 0.39
IGL02434:Rsbn1l APN 5 20919734 missense probably damaging 0.99
IGL02458:Rsbn1l APN 5 20951736 missense probably damaging 0.99
IGL02994:Rsbn1l APN 5 20908234 missense probably damaging 1.00
R0288:Rsbn1l UTSW 5 20920040 missense probably damaging 0.97
R1429:Rsbn1l UTSW 5 20920018 missense probably damaging 1.00
R1524:Rsbn1l UTSW 5 20951673 missense probably damaging 1.00
R1713:Rsbn1l UTSW 5 20951490 missense probably benign 0.18
R1875:Rsbn1l UTSW 5 20951698 missense probably benign 0.17
R1998:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R1999:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R2000:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R2504:Rsbn1l UTSW 5 20902366 missense probably damaging 1.00
R2566:Rsbn1l UTSW 5 20919769 missense probably benign 0.40
R3434:Rsbn1l UTSW 5 20905930 splice site probably benign
R3789:Rsbn1l UTSW 5 20896108 missense probably benign 0.24
R3893:Rsbn1l UTSW 5 20905840 missense probably damaging 1.00
R4335:Rsbn1l UTSW 5 20908193 missense probably null 0.45
R4422:Rsbn1l UTSW 5 20896546 missense probably damaging 1.00
R5131:Rsbn1l UTSW 5 20896245 missense possibly damaging 0.89
R5212:Rsbn1l UTSW 5 20896214 missense probably benign 0.03
R5739:Rsbn1l UTSW 5 20905816 missense probably damaging 1.00
R6736:Rsbn1l UTSW 5 20908224 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AAGCCTCTTACCTGAGCATG -3'
(R):5'- TGTCTGCTGAAGATCAAGAAGC -3'

Sequencing Primer
(F):5'- GCCTCTTACCTGAGCATGAAAATTGG -3'
(R):5'- GCCAAAAGCATCTTAAGTGATAATG -3'
Posted On2015-04-17