Incidental Mutation 'R3924:4930550C14Rik'
ID307094
Institutional Source Beutler Lab
Gene Symbol 4930550C14Rik
Ensembl Gene ENSMUSG00000005131
Gene NameRIKEN cDNA 4930550C14 gene
Synonyms
MMRRC Submission 040915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3924 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53402325-53434402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53432405 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 119 (V119F)
Ref Sequence ENSEMBL: ENSMUSP00000149814 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000005262
AA Change: V264F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215668
AA Change: V119F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217318
AA Change: V119F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,500,407 V533D probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Aldh3b3 A G 19: 3,968,491 N402S probably damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
Arpin A G 7: 79,929,687 Y63H probably benign Het
Brinp2 A G 1: 158,246,208 L781P probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Csad T C 15: 102,178,556 S427G probably benign Het
Dach1 A G 14: 97,915,903 V443A probably damaging Het
Dlat A G 9: 50,658,190 S160P possibly damaging Het
Dpf1 A G 7: 29,311,673 R165G possibly damaging Het
Dtd2 G C 12: 52,004,951 probably null Het
Fa2h A G 8: 111,393,515 Y80H probably damaging Het
Flii A G 11: 60,720,076 F509S probably damaging Het
Fmo9 A G 1: 166,664,652 S350P probably benign Het
Gabra4 A G 5: 71,642,253 probably benign Het
Gm3604 A G 13: 62,370,230 S105P probably damaging Het
Gpr155 T A 2: 73,370,076 L362F probably damaging Het
Lmbrd2 T C 15: 9,149,537 V86A probably benign Het
Lpcat4 G T 2: 112,246,716 Q468H possibly damaging Het
Luzp1 T C 4: 136,542,857 I797T probably damaging Het
Myh8 A T 11: 67,297,137 I912F probably damaging Het
Notch2 G T 3: 98,122,034 G1038* probably null Het
Nptx1 G T 11: 119,547,507 T28N possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Plekha5 A G 6: 140,570,379 N317S possibly damaging Het
Polr1a A G 6: 71,929,450 M417V probably benign Het
Ptpn13 T C 5: 103,550,741 probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rasd2 A G 8: 75,221,974 N176S probably damaging Het
Rsbn1l A G 5: 20,919,787 V339A probably damaging Het
Ryr3 A G 2: 113,028,703 probably benign Het
Shkbp1 A G 7: 27,342,402 W676R probably benign Het
Sipa1 G A 19: 5,660,379 T201I probably benign Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Zfp946 G T 17: 22,455,701 G479C probably benign Het
Other mutations in 4930550C14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0310:4930550C14Rik UTSW 9 53425671 missense probably damaging 1.00
R0625:4930550C14Rik UTSW 9 53408065 missense probably benign
R1104:4930550C14Rik UTSW 9 53421617 missense probably benign 0.28
R1292:4930550C14Rik UTSW 9 53425619 missense probably benign 0.20
R2182:4930550C14Rik UTSW 9 53422943 missense probably damaging 1.00
R4756:4930550C14Rik UTSW 9 53425530 missense probably benign
R4757:4930550C14Rik UTSW 9 53425530 missense probably benign
R4834:4930550C14Rik UTSW 9 53432487 missense possibly damaging 0.78
R5244:4930550C14Rik UTSW 9 53411798 missense probably damaging 1.00
R6151:4930550C14Rik UTSW 9 53414383 missense probably damaging 1.00
R6353:4930550C14Rik UTSW 9 53414342 missense probably benign 0.00
R6376:4930550C14Rik UTSW 9 53428156 missense probably damaging 0.98
R6988:4930550C14Rik UTSW 9 53411756 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACATGTGCTCAAAGTGTGGAC -3'
(R):5'- GGAATCCTTTCTGGTTACATGC -3'

Sequencing Primer
(F):5'- GACTATAGAGCAAGATTTAGTGTGTG -3'
(R):5'- CCGAACATGGAATCGGGTGTTAATC -3'
Posted On2015-04-17