Incidental Mutation 'R3924:Amn'
ID307101
Institutional Source Beutler Lab
Gene Symbol Amn
Ensembl Gene ENSMUSG00000021278
Gene Nameamnionless
Synonyms
MMRRC Submission 040915-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3924 (G1)
Quality Score208
Status Validated
Chromosome12
Chromosomal Location111271095-111276426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111275680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 367 (V367A)
Ref Sequence ENSEMBL: ENSMUSP00000021707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021707]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021707
AA Change: V367A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021707
Gene: ENSMUSG00000021278
AA Change: V367A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Amnionless 21 451 6.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220903
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein. The encoded protein is an essential component of the cubulin receptor complex which is thought to play a role in coordinating growth and patterning of the embryo. This protein is thought to modulate a bone morphogenetic protein (BMP) signaling pathway. A homoygous mutation in the mouse gene results in the lack of an amnion in embryos. Mutations in the human gene are associated with Megaloblastic Anemia-1. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth arrest between the mid and late streak stages of gastrulation and abnormal ectoderm formation, followed by death. Generation of middle primitive streak derivatives is impaired, leading to absence of mesoderm and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,432,405 V119F probably benign Het
Agtpbp1 A T 13: 59,500,407 V533D probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Aldh3b3 A G 19: 3,968,491 N402S probably damaging Het
Arpin A G 7: 79,929,687 Y63H probably benign Het
Brinp2 A G 1: 158,246,208 L781P probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Csad T C 15: 102,178,556 S427G probably benign Het
Dach1 A G 14: 97,915,903 V443A probably damaging Het
Dlat A G 9: 50,658,190 S160P possibly damaging Het
Dpf1 A G 7: 29,311,673 R165G possibly damaging Het
Dtd2 G C 12: 52,004,951 probably null Het
Fa2h A G 8: 111,393,515 Y80H probably damaging Het
Flii A G 11: 60,720,076 F509S probably damaging Het
Fmo9 A G 1: 166,664,652 S350P probably benign Het
Gabra4 A G 5: 71,642,253 probably benign Het
Gm3604 A G 13: 62,370,230 S105P probably damaging Het
Gpr155 T A 2: 73,370,076 L362F probably damaging Het
Lmbrd2 T C 15: 9,149,537 V86A probably benign Het
Lpcat4 G T 2: 112,246,716 Q468H possibly damaging Het
Luzp1 T C 4: 136,542,857 I797T probably damaging Het
Myh8 A T 11: 67,297,137 I912F probably damaging Het
Notch2 G T 3: 98,122,034 G1038* probably null Het
Nptx1 G T 11: 119,547,507 T28N possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Plekha5 A G 6: 140,570,379 N317S possibly damaging Het
Polr1a A G 6: 71,929,450 M417V probably benign Het
Ptpn13 T C 5: 103,550,741 probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rasd2 A G 8: 75,221,974 N176S probably damaging Het
Rsbn1l A G 5: 20,919,787 V339A probably damaging Het
Ryr3 A G 2: 113,028,703 probably benign Het
Shkbp1 A G 7: 27,342,402 W676R probably benign Het
Sipa1 G A 19: 5,660,379 T201I probably benign Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Zfp946 G T 17: 22,455,701 G479C probably benign Het
Other mutations in Amn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Amn APN 12 111271793 missense probably damaging 0.97
IGL02397:Amn APN 12 111274479 missense possibly damaging 0.77
IGL02962:Amn APN 12 111274517 missense probably damaging 1.00
IGL02974:Amn APN 12 111271141 missense probably benign 0.01
IGL02837:Amn UTSW 12 111271899 missense possibly damaging 0.74
R0357:Amn UTSW 12 111274141 critical splice acceptor site probably null
R1986:Amn UTSW 12 111274997 missense probably damaging 1.00
R1993:Amn UTSW 12 111276092 missense probably damaging 1.00
R2355:Amn UTSW 12 111271812 missense probably damaging 0.99
R3925:Amn UTSW 12 111275680 missense possibly damaging 0.71
R4364:Amn UTSW 12 111271762 missense probably damaging 0.99
R4687:Amn UTSW 12 111276068 missense probably benign 0.35
R6176:Amn UTSW 12 111274156 missense possibly damaging 0.55
R6209:Amn UTSW 12 111275411 missense probably damaging 0.99
R6300:Amn UTSW 12 111274189 missense probably benign 0.16
R6591:Amn UTSW 12 111275397 missense possibly damaging 0.77
R6691:Amn UTSW 12 111275397 missense possibly damaging 0.77
X0025:Amn UTSW 12 111275399 missense probably damaging 1.00
Z1088:Amn UTSW 12 111275683 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATGACAGAGTCCGGACCAAC -3'
(R):5'- AATCGGATTTCGGAAACCCAG -3'

Sequencing Primer
(F):5'- ACACCGAGATCCAGGTGGTG -3'
(R):5'- ATACGGGCTCAGCGTCTTCATG -3'
Posted On2015-04-17