Incidental Mutation 'R3936:Mc3r'
ID307163
Institutional Source Beutler Lab
Gene Symbol Mc3r
Ensembl Gene ENSMUSG00000038537
Gene Namemelanocortin 3 receptor
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R3936 (G1)
Quality Score208
Status Not validated
Chromosome2
Chromosomal Location172248492-172251114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172249296 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 146 (I146N)
Ref Sequence ENSEMBL: ENSMUSP00000047358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038532]
Predicted Effect probably damaging
Transcript: ENSMUST00000038532
AA Change: I146N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047358
Gene: ENSMUSG00000038537
AA Change: I146N

DomainStartEndE-ValueType
Pfam:7tm_4 45 198 3.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 49 314 1.9e-7 PFAM
Pfam:7tm_1 55 299 5.4e-35 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis and adaptation to food restriction. Disruption of this gene results in an increased ratio of weight gain to food intake, increased fat mass, and decreased lean mass, without having a large effect on insulin sensitivity or glucose metabolism. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele exhibit obesity, increased respiratory quotient on a high fat diet, and reduced energy expenditure. Homozygotes for another null allele show reduced lean mass, increased fat mass, diet-induced obesity, increased insulin and leptin levels, and reduced energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Mc3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Mc3r APN 2 172249028 missense possibly damaging 0.95
IGL01618:Mc3r APN 2 172249370 missense probably benign
IGL01784:Mc3r APN 2 172249370 missense probably benign
IGL01865:Mc3r APN 2 172249055 missense probably damaging 1.00
IGL02164:Mc3r APN 2 172249394 missense probably damaging 1.00
IGL03011:Mc3r APN 2 172249796 missense probably benign 0.08
IGL03266:Mc3r APN 2 172249269 missense probably benign 0.01
R0882:Mc3r UTSW 2 172249791 missense probably benign 0.00
R1005:Mc3r UTSW 2 172249563 missense probably benign 0.00
R1501:Mc3r UTSW 2 172249380 missense probably benign 0.19
R2374:Mc3r UTSW 2 172249154 missense possibly damaging 0.84
R3437:Mc3r UTSW 2 172249668 missense probably benign 0.23
R3813:Mc3r UTSW 2 172248879 missense probably benign 0.06
R4225:Mc3r UTSW 2 172249034 missense probably damaging 1.00
R4491:Mc3r UTSW 2 172249203 missense possibly damaging 0.50
R5074:Mc3r UTSW 2 172249613 missense possibly damaging 0.95
R5277:Mc3r UTSW 2 172249787 missense probably damaging 1.00
R5706:Mc3r UTSW 2 172249690 nonsense probably null
R5832:Mc3r UTSW 2 172249430 missense probably benign 0.01
R5865:Mc3r UTSW 2 172249672 missense possibly damaging 0.84
R5881:Mc3r UTSW 2 172249172 missense probably benign 0.22
R5905:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R6028:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R6492:Mc3r UTSW 2 172249154 missense possibly damaging 0.84
R7037:Mc3r UTSW 2 172249634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTCAGGAATGGCAACC -3'
(R):5'- TATAGGGTGCCCATGAGGAG -3'

Sequencing Primer
(F):5'- ATGCTGGTGAGCCTGTCCAAC -3'
(R):5'- TGCCCATGAGGAGCACCATG -3'
Posted On2015-04-17