Incidental Mutation 'R3936:Sult2b1'
ID307172
Institutional Source Beutler Lab
Gene Symbol Sult2b1
Ensembl Gene ENSMUSG00000003271
Gene Namesulfotransferase family, cytosolic, 2B, member 1
SynonymsSULT2B
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45729983-45784669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45742216 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 49 (V49M)
Ref Sequence ENSEMBL: ENSMUSP00000148064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075571] [ENSMUST00000209739] [ENSMUST00000210147] [ENSMUST00000210754]
Predicted Effect probably benign
Transcript: ENSMUST00000075571
SMART Domains Protein: ENSMUSP00000075005
Gene: ENSMUSG00000003271

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 57 302 7.8e-84 PFAM
low complexity region 309 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107735
AA Change: V49M

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103363
Gene: ENSMUSG00000003271
AA Change: V49M

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 91 336 5.2e-84 PFAM
Pfam:Sulfotransfer_3 92 262 5.1e-11 PFAM
low complexity region 343 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209435
Predicted Effect probably benign
Transcript: ENSMUST00000209739
Predicted Effect probably benign
Transcript: ENSMUST00000210147
Predicted Effect probably benign
Transcript: ENSMUST00000210754
AA Change: V49M

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211176
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cholesterol sulfate in the dermis but otherwise appear to have normal lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Sult2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02415:Sult2b1 APN 7 45742085 missense possibly damaging 0.86
IGL02964:Sult2b1 APN 7 45735274 missense probably benign 0.01
IGL03208:Sult2b1 APN 7 45733629 missense probably damaging 1.00
R0392:Sult2b1 UTSW 7 45733638 missense probably damaging 1.00
R0415:Sult2b1 UTSW 7 45730092 unclassified probably benign
R2247:Sult2b1 UTSW 7 45735310 missense probably damaging 1.00
R3851:Sult2b1 UTSW 7 45730037 unclassified probably benign
R3935:Sult2b1 UTSW 7 45742216 missense probably benign 0.09
R4179:Sult2b1 UTSW 7 45735311 missense probably damaging 1.00
R4723:Sult2b1 UTSW 7 45742065 missense probably damaging 1.00
R5634:Sult2b1 UTSW 7 45734082 missense probably damaging 0.99
R5782:Sult2b1 UTSW 7 45731346 missense probably damaging 1.00
R6562:Sult2b1 UTSW 7 45742246 missense probably benign 0.00
R6816:Sult2b1 UTSW 7 45733678 missense probably damaging 1.00
R6921:Sult2b1 UTSW 7 45735188 missense probably damaging 1.00
R7145:Sult2b1 UTSW 7 45733632 missense probably damaging 1.00
R7250:Sult2b1 UTSW 7 45783937 missense unknown
R7392:Sult2b1 UTSW 7 45742438 start gained probably benign
R7398:Sult2b1 UTSW 7 45731294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACCGGTACCTGATTTGGGG -3'
(R):5'- TCCTCCTACCAGAAGCGTAG -3'

Sequencing Primer
(F):5'- GTAGGTGACAATGAAGATGTCGTC -3'
(R):5'- TTTGGGCGAGTCACTCCC -3'
Posted On2015-04-17