Incidental Mutation 'R3936:Treh'
ID307174
Institutional Source Beutler Lab
Gene Symbol Treh
Ensembl Gene ENSMUSG00000032098
Gene Nametrehalase (brush-border membrane glycoprotein)
Synonyms2210412M19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44673233-44686305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44684543 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 342 (R342W)
Ref Sequence ENSEMBL: ENSMUSP00000071206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034609] [ENSMUST00000034611] [ENSMUST00000071219] [ENSMUST00000134465] [ENSMUST00000135436] [ENSMUST00000138356] [ENSMUST00000139389] [ENSMUST00000144251] [ENSMUST00000147495] [ENSMUST00000150822] [ENSMUST00000156918]
Predicted Effect probably benign
Transcript: ENSMUST00000034609
AA Change: R377W

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034609
Gene: ENSMUSG00000032098
AA Change: R377W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Trehalase 43 548 2.3e-185 PFAM
low complexity region 565 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034611
SMART Domains Protein: ENSMUSP00000034611
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5.01e-5 PROSPERO
internal_repeat_1 401 449 5.01e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1366 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071219
AA Change: R342W

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071206
Gene: ENSMUSG00000032098
AA Change: R342W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Trehalase 134 513 7e-145 PFAM
low complexity region 530 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128326
SMART Domains Protein: ENSMUSP00000119966
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
coiled coil region 357 396 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 493 506 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 564 572 N/A INTRINSIC
coiled coil region 610 679 N/A INTRINSIC
PH 723 827 1.31e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129806
Predicted Effect probably benign
Transcript: ENSMUST00000134465
SMART Domains Protein: ENSMUSP00000117395
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 8e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 6.75e-5 PROSPERO
internal_repeat_1 401 449 6.75e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 929 950 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
coiled coil region 1103 1172 N/A INTRINSIC
PH 1215 1319 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135436
SMART Domains Protein: ENSMUSP00000120023
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
coiled coil region 274 343 N/A INTRINSIC
PH 386 490 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138356
SMART Domains Protein: ENSMUSP00000120208
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 4.93e-5 PROSPERO
internal_repeat_1 401 449 4.93e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 931 948 N/A INTRINSIC
low complexity region 999 1017 N/A INTRINSIC
low complexity region 1032 1053 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
low complexity region 1159 1167 N/A INTRINSIC
coiled coil region 1206 1286 N/A INTRINSIC
PH 1329 1444 6.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139389
SMART Domains Protein: ENSMUSP00000120671
Gene: ENSMUSG00000032098

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Trehalase 43 141 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144251
SMART Domains Protein: ENSMUSP00000114773
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
coiled coil region 146 174 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
coiled coil region 225 264 N/A INTRINSIC
low complexity region 289 310 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
low complexity region 416 424 N/A INTRINSIC
coiled coil region 463 532 N/A INTRINSIC
PH 575 679 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147495
SMART Domains Protein: ENSMUSP00000122661
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5e-5 PROSPERO
internal_repeat_1 401 449 5e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1377 6.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148344
SMART Domains Protein: ENSMUSP00000121809
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
internal_repeat_1 66 99 6.7e-6 PROSPERO
internal_repeat_1 146 194 6.7e-6 PROSPERO
low complexity region 204 222 N/A INTRINSIC
low complexity region 335 362 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
coiled coil region 459 542 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
coiled coil region 609 648 N/A INTRINSIC
low complexity region 688 706 N/A INTRINSIC
low complexity region 721 742 N/A INTRINSIC
low complexity region 792 805 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 863 871 N/A INTRINSIC
coiled coil region 909 978 N/A INTRINSIC
PH 1022 1126 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150822
SMART Domains Protein: ENSMUSP00000123144
Gene: ENSMUSG00000032098

DomainStartEndE-ValueType
Pfam:Trehalase 1 121 3.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156918
SMART Domains Protein: ENSMUSP00000120092
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
low complexity region 136 146 N/A INTRINSIC
coiled coil region 182 221 N/A INTRINSIC
low complexity region 246 267 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
low complexity region 373 381 N/A INTRINSIC
coiled coil region 420 489 N/A INTRINSIC
PH 532 636 1.31e-17 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the alpha-glucosidase family, whose members encode enzymes that carry out hydrolysis of alpha-glucoside bonds of a variety of carbohydrates. The enzyme encoded by this gene uses the disaccharide trehalose as a highly specific substrate and converts it into two glucose molecules. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit a rapid increase in blood glucose levels following oral trehalose administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Other mutations in Treh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Treh APN 9 44683900 missense probably damaging 1.00
IGL00984:Treh APN 9 44682967 unclassified probably benign
IGL02111:Treh APN 9 44682961 missense probably benign 0.02
IGL02493:Treh APN 9 44682949 missense possibly damaging 0.92
IGL03242:Treh APN 9 44685337 missense possibly damaging 0.51
IGL03392:Treh APN 9 44685931 missense probably damaging 0.96
R0041:Treh UTSW 9 44683613 missense probably benign 0.27
R1391:Treh UTSW 9 44685305 missense probably benign 0.02
R2099:Treh UTSW 9 44684646 missense probably damaging 1.00
R2142:Treh UTSW 9 44681141 missense probably damaging 1.00
R4577:Treh UTSW 9 44685911 missense probably benign 0.11
R4715:Treh UTSW 9 44683318 missense probably benign 0.44
R4735:Treh UTSW 9 44681552 missense probably damaging 1.00
R4964:Treh UTSW 9 44682648 missense probably damaging 0.99
R5028:Treh UTSW 9 44682889 missense probably null 0.96
R5214:Treh UTSW 9 44682876 missense probably damaging 1.00
R5645:Treh UTSW 9 44682678 missense probably damaging 0.99
R7311:Treh UTSW 9 44685948 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATGTTAGTTCAAGGAGCCATG -3'
(R):5'- TACTTCAGAGCCTTGTCAGC -3'

Sequencing Primer
(F):5'- GCCATGAATTCTAGTGGGCAC -3'
(R):5'- TTGTCAGCAACACTAGGGTC -3'
Posted On2015-04-17